ID: 941122089

View in Genome Browser
Species Human (GRCh38)
Location 2:161542142-161542164
Sequence GAAGATTAATAAGGAAACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941122086_941122089 7 Left 941122086 2:161542112-161542134 CCTCACTTTCAATGATAGATTAT No data
Right 941122089 2:161542142-161542164 GAAGATTAATAAGGAAACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941122089 Original CRISPR GAAGATTAATAAGGAAACAC TGG Intronic
No off target data available for this crispr