ID: 941128711

View in Genome Browser
Species Human (GRCh38)
Location 2:161619509-161619531
Sequence ATGTAAACACATGTGAATTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941128710_941128711 -7 Left 941128710 2:161619493-161619515 CCTTTACATAAATAATATGTAAA No data
Right 941128711 2:161619509-161619531 ATGTAAACACATGTGAATTGTGG No data
941128709_941128711 -6 Left 941128709 2:161619492-161619514 CCCTTTACATAAATAATATGTAA No data
Right 941128711 2:161619509-161619531 ATGTAAACACATGTGAATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941128711 Original CRISPR ATGTAAACACATGTGAATTG TGG Intronic
No off target data available for this crispr