ID: 941129566

View in Genome Browser
Species Human (GRCh38)
Location 2:161629707-161629729
Sequence CCTCCCTTTCCACTAACCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941129561_941129566 9 Left 941129561 2:161629675-161629697 CCTAAAGATCCTCTGTGCTCTGC No data
Right 941129566 2:161629707-161629729 CCTCCCTTTCCACTAACCCCTGG No data
941129562_941129566 0 Left 941129562 2:161629684-161629706 CCTCTGTGCTCTGCCTATTCATC 0: 69
1: 220
2: 391
3: 639
4: 1410
Right 941129566 2:161629707-161629729 CCTCCCTTTCCACTAACCCCTGG No data
941129560_941129566 10 Left 941129560 2:161629674-161629696 CCCTAAAGATCCTCTGTGCTCTG No data
Right 941129566 2:161629707-161629729 CCTCCCTTTCCACTAACCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941129566 Original CRISPR CCTCCCTTTCCACTAACCCC TGG Intronic
No off target data available for this crispr