ID: 941132377

View in Genome Browser
Species Human (GRCh38)
Location 2:161669225-161669247
Sequence TCCCATAATCCCAATTTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941132377_941132382 4 Left 941132377 2:161669225-161669247 CCTACCAAATTGGGATTATGGGA No data
Right 941132382 2:161669252-161669274 GTAGGATTTGTGGCCTTTGTGGG No data
941132377_941132381 3 Left 941132377 2:161669225-161669247 CCTACCAAATTGGGATTATGGGA No data
Right 941132381 2:161669251-161669273 TGTAGGATTTGTGGCCTTTGTGG No data
941132377_941132384 23 Left 941132377 2:161669225-161669247 CCTACCAAATTGGGATTATGGGA No data
Right 941132384 2:161669271-161669293 TGGGCAAACATTGCTTATGCAGG No data
941132377_941132380 -6 Left 941132377 2:161669225-161669247 CCTACCAAATTGGGATTATGGGA No data
Right 941132380 2:161669242-161669264 ATGGGATCATGTAGGATTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941132377 Original CRISPR TCCCATAATCCCAATTTGGT AGG (reversed) Intronic
No off target data available for this crispr