ID: 941137813

View in Genome Browser
Species Human (GRCh38)
Location 2:161739232-161739254
Sequence CAGATTAACCAGAAAAATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941137808_941137813 -2 Left 941137808 2:161739211-161739233 CCTTCGCTACCCTCTTTTATCCA No data
Right 941137813 2:161739232-161739254 CAGATTAACCAGAAAAATGGAGG No data
941137807_941137813 30 Left 941137807 2:161739179-161739201 CCTTGATAAGAATTGCATAGTCA No data
Right 941137813 2:161739232-161739254 CAGATTAACCAGAAAAATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941137813 Original CRISPR CAGATTAACCAGAAAAATGG AGG Intronic
No off target data available for this crispr