ID: 941139369

View in Genome Browser
Species Human (GRCh38)
Location 2:161759512-161759534
Sequence TCATATAAGCAGAGTGTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941139369_941139370 9 Left 941139369 2:161759512-161759534 CCTTCTACACTCTGCTTATATGA No data
Right 941139370 2:161759544-161759566 TTATTTAAGATTCTACATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941139369 Original CRISPR TCATATAAGCAGAGTGTAGA AGG (reversed) Intronic
No off target data available for this crispr