ID: 941141468

View in Genome Browser
Species Human (GRCh38)
Location 2:161788645-161788667
Sequence CTGGAGAAATGCCCCTTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941141463_941141468 1 Left 941141463 2:161788621-161788643 CCCAAGCTGAAGTGTGACTGAGG No data
Right 941141468 2:161788645-161788667 CTGGAGAAATGCCCCTTTGGTGG No data
941141465_941141468 0 Left 941141465 2:161788622-161788644 CCAAGCTGAAGTGTGACTGAGGT No data
Right 941141468 2:161788645-161788667 CTGGAGAAATGCCCCTTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941141468 Original CRISPR CTGGAGAAATGCCCCTTTGG TGG Intronic
No off target data available for this crispr