ID: 941143589

View in Genome Browser
Species Human (GRCh38)
Location 2:161815656-161815678
Sequence GATGCTAGGCTTCAACCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941143587_941143589 2 Left 941143587 2:161815631-161815653 CCTGAGAAGCTTTAAAAAAATTA No data
Right 941143589 2:161815656-161815678 GATGCTAGGCTTCAACCTCAAGG No data
941143586_941143589 23 Left 941143586 2:161815610-161815632 CCTTCTGGCACATTGGAATCACC No data
Right 941143589 2:161815656-161815678 GATGCTAGGCTTCAACCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941143589 Original CRISPR GATGCTAGGCTTCAACCTCA AGG Intronic
No off target data available for this crispr