ID: 941143589 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:161815656-161815678 |
| Sequence | GATGCTAGGCTTCAACCTCA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 941143587_941143589 | 2 | Left | 941143587 | 2:161815631-161815653 | CCTGAGAAGCTTTAAAAAAATTA | No data | ||
| Right | 941143589 | 2:161815656-161815678 | GATGCTAGGCTTCAACCTCAAGG | No data | ||||
| 941143586_941143589 | 23 | Left | 941143586 | 2:161815610-161815632 | CCTTCTGGCACATTGGAATCACC | No data | ||
| Right | 941143589 | 2:161815656-161815678 | GATGCTAGGCTTCAACCTCAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 941143589 | Original CRISPR | GATGCTAGGCTTCAACCTCA AGG | Intronic | ||
| No off target data available for this crispr | |||||