ID: 941144764

View in Genome Browser
Species Human (GRCh38)
Location 2:161831033-161831055
Sequence CAGCTACAAGATTCTGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941144762_941144764 18 Left 941144762 2:161830992-161831014 CCAAAGTATACTACATTTAAGCA No data
Right 941144764 2:161831033-161831055 CAGCTACAAGATTCTGAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941144764 Original CRISPR CAGCTACAAGATTCTGAGGT AGG Intronic
No off target data available for this crispr