ID: 941151274

View in Genome Browser
Species Human (GRCh38)
Location 2:161918731-161918753
Sequence TTTGCAGCAGCCACTTCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941151274_941151275 -5 Left 941151274 2:161918731-161918753 CCATCTGAAGTGGCTGCTGCAAA No data
Right 941151275 2:161918749-161918771 GCAAAGATGCCAGCTGCAGTAGG No data
941151274_941151276 -4 Left 941151274 2:161918731-161918753 CCATCTGAAGTGGCTGCTGCAAA No data
Right 941151276 2:161918750-161918772 CAAAGATGCCAGCTGCAGTAGGG No data
941151274_941151277 -1 Left 941151274 2:161918731-161918753 CCATCTGAAGTGGCTGCTGCAAA No data
Right 941151277 2:161918753-161918775 AGATGCCAGCTGCAGTAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941151274 Original CRISPR TTTGCAGCAGCCACTTCAGA TGG (reversed) Intronic
No off target data available for this crispr