ID: 941151277

View in Genome Browser
Species Human (GRCh38)
Location 2:161918753-161918775
Sequence AGATGCCAGCTGCAGTAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941151273_941151277 0 Left 941151273 2:161918730-161918752 CCCATCTGAAGTGGCTGCTGCAA No data
Right 941151277 2:161918753-161918775 AGATGCCAGCTGCAGTAGGGAGG No data
941151274_941151277 -1 Left 941151274 2:161918731-161918753 CCATCTGAAGTGGCTGCTGCAAA No data
Right 941151277 2:161918753-161918775 AGATGCCAGCTGCAGTAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941151277 Original CRISPR AGATGCCAGCTGCAGTAGGG AGG Intronic
No off target data available for this crispr