ID: 941153418

View in Genome Browser
Species Human (GRCh38)
Location 2:161943261-161943283
Sequence TCCAGCTGTTCCGGATCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941153416_941153418 27 Left 941153416 2:161943211-161943233 CCTTCTGTGTAAAGAACTCAGAA No data
Right 941153418 2:161943261-161943283 TCCAGCTGTTCCGGATCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941153418 Original CRISPR TCCAGCTGTTCCGGATCTGC TGG Intronic
No off target data available for this crispr