ID: 941157707

View in Genome Browser
Species Human (GRCh38)
Location 2:161999532-161999554
Sequence CCTGGCAAGGAGAAGTGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941157701_941157707 -7 Left 941157701 2:161999516-161999538 CCGCTGCCAGCAACAGCCTGGCA No data
Right 941157707 2:161999532-161999554 CCTGGCAAGGAGAAGTGGGAAGG No data
941157696_941157707 20 Left 941157696 2:161999489-161999511 CCTGAGGCTAGAAACTTCCGGAG No data
Right 941157707 2:161999532-161999554 CCTGGCAAGGAGAAGTGGGAAGG No data
941157697_941157707 3 Left 941157697 2:161999506-161999528 CCGGAGAGCCCCGCTGCCAGCAA No data
Right 941157707 2:161999532-161999554 CCTGGCAAGGAGAAGTGGGAAGG No data
941157698_941157707 -5 Left 941157698 2:161999514-161999536 CCCCGCTGCCAGCAACAGCCTGG No data
Right 941157707 2:161999532-161999554 CCTGGCAAGGAGAAGTGGGAAGG No data
941157700_941157707 -6 Left 941157700 2:161999515-161999537 CCCGCTGCCAGCAACAGCCTGGC No data
Right 941157707 2:161999532-161999554 CCTGGCAAGGAGAAGTGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941157707 Original CRISPR CCTGGCAAGGAGAAGTGGGA AGG Intronic
No off target data available for this crispr