ID: 941158891

View in Genome Browser
Species Human (GRCh38)
Location 2:162012814-162012836
Sequence GTGGAGAGATGGGCTGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941158891_941158900 8 Left 941158891 2:162012814-162012836 CCCTCCCCAGCCCATCTCTCCAC No data
Right 941158900 2:162012845-162012867 TTACTGTCCCTGCACAGGATAGG No data
941158891_941158899 3 Left 941158891 2:162012814-162012836 CCCTCCCCAGCCCATCTCTCCAC No data
Right 941158899 2:162012840-162012862 TCTGCTTACTGTCCCTGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941158891 Original CRISPR GTGGAGAGATGGGCTGGGGA GGG (reversed) Intronic
No off target data available for this crispr