ID: 941159982

View in Genome Browser
Species Human (GRCh38)
Location 2:162024873-162024895
Sequence TTTCTTTGCAGTGGCTCAGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 210}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941159982_941159988 29 Left 941159982 2:162024873-162024895 CCTCCTGAGCCACTGCAAAGAAA 0: 1
1: 0
2: 0
3: 24
4: 210
Right 941159988 2:162024925-162024947 CACAAGTAGTGATCCCTGGAAGG 0: 1
1: 0
2: 0
3: 7
4: 106
941159982_941159987 25 Left 941159982 2:162024873-162024895 CCTCCTGAGCCACTGCAAAGAAA 0: 1
1: 0
2: 0
3: 24
4: 210
Right 941159987 2:162024921-162024943 ATCACACAAGTAGTGATCCCTGG 0: 1
1: 0
2: 0
3: 7
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941159982 Original CRISPR TTTCTTTGCAGTGGCTCAGG AGG (reversed) Exonic
900286335 1:1902303-1902325 TTTTTTTACAGTAGCTCATGAGG - Intergenic
901440662 1:9276072-9276094 GTTCTCTGCTGTGGCTCAGTAGG - Intergenic
901650156 1:10738499-10738521 TATCCTGGCAGTGGCTCTGGAGG - Intronic
904801275 1:33094476-33094498 ATTCTTGGCTGGGGCTCAGGTGG + Intronic
905009813 1:34739635-34739657 TTTCTGTCCAGTGGCTTTGGGGG - Intronic
905467912 1:38169499-38169521 TTTCTTTGTAGTTGATAAGGAGG - Intergenic
905632597 1:39526999-39527021 TTGCTCTGCAGTGGGGCAGGAGG - Intergenic
908515051 1:64884004-64884026 TTTGTGTGCAGTGTCTCAGGTGG - Intronic
908600128 1:65729658-65729680 TATGTTTGCAGAGGCTCAAGGGG + Intergenic
909142565 1:71887269-71887291 TGTCTTAGCGGTGGCACAGGTGG + Intronic
909196569 1:72634025-72634047 TTTCTTTTCATAGCCTCAGGTGG + Intergenic
913234426 1:116767653-116767675 CGTCTTTGCAGTGGCTCCAGAGG - Intronic
915138250 1:153749150-153749172 TCTTTTTGAAGTGGCACAGGGGG + Intronic
915276461 1:154792173-154792195 CTGCTTTGCAGAGGGTCAGGTGG + Intronic
916494159 1:165329617-165329639 TTTTTTTGCAGTGGCGGGGGTGG - Intronic
917304898 1:173614936-173614958 TGTCATTGCAGCTGCTCAGGAGG - Intronic
918450851 1:184656543-184656565 TTTCTTTGAACTGGCTGAGTGGG - Intergenic
919279440 1:195468439-195468461 TTTCTCTGTAGTGGCTCTTGAGG + Intergenic
921394973 1:214658956-214658978 TTTCTTTGCCGAGACTCAGTGGG - Exonic
922929871 1:229380868-229380890 TTTCTTTGCAGTGTTGAAGGTGG + Intergenic
924027845 1:239855957-239855979 TTTCTTAGCAGTTTCTCAGGAGG + Intronic
924173896 1:241369695-241369717 TCTCTCTGCAGTGGCTCAACGGG - Intergenic
1065602420 10:27383151-27383173 ATTCTTTGCAATGGCTTAGGGGG + Intergenic
1070497649 10:77038952-77038974 TCTCTTTCCACTGGCTCAGCAGG - Intronic
1070675817 10:78410557-78410579 TTTCCCTTCAGTGTCTCAGGAGG + Intergenic
1072722373 10:97788938-97788960 CTATTTTGCAGTGGCTCAGCCGG + Intergenic
1075367880 10:121908781-121908803 TTTTTTTGCCGTGGGGCAGGGGG - Intronic
1075403317 10:122176883-122176905 ATTCCTTTCTGTGGCTCAGGGGG - Intronic
1076040878 10:127247454-127247476 TTTCTTTGCCATGGCCCAAGAGG + Intronic
1077643873 11:3905986-3906008 TTACTTACCAGTGGCTCTGGTGG + Intronic
1083582663 11:63835058-63835080 TTTGTTTTCAGTTGTTCAGGCGG + Intergenic
1083632301 11:64102084-64102106 TTTCTTTGTAGGGCCTAAGGTGG - Intronic
1085678298 11:78546312-78546334 TTTTTTTGGAATGGCTCCGGGGG - Intronic
1086792232 11:91056965-91056987 TTTTTTTGCATTTGCTAAGGAGG + Intergenic
1089126883 11:116182669-116182691 TCTCTTTGTAGTGCCTCTGGAGG - Intergenic
1089656507 11:119950809-119950831 TCTCCCTGCAGTGGCTCACGGGG - Intergenic
1091561027 12:1613599-1613621 TTTATTTGTAGTTGCTCAAGGGG - Intronic
1095826315 12:46533441-46533463 TTTCTTTGCAGAGAATCAGATGG - Intergenic
1099111578 12:78568566-78568588 GTTCATTGCAGTTGCTCAGTTGG - Intergenic
1101271354 12:103149033-103149055 TGTCTTTGTAGAGGGTCAGGTGG + Intergenic
1104070984 12:125345154-125345176 TCTCTTTCCAGTGGGCCAGGTGG - Intronic
1105669141 13:22593018-22593040 TTGCCTGGCAGTGGCTCATGAGG - Intergenic
1107130766 13:36892377-36892399 TTTCTTTGCACTTGCTAGGGTGG - Intronic
1108991282 13:56660756-56660778 TTTCTTTGCAGTGTCTGATATGG - Intergenic
1110663342 13:78085609-78085631 TTTCCTTGCAGTGGCCAAGGCGG + Intergenic
1112169670 13:96957924-96957946 TTTGTTTGCATTGACACAGGCGG - Intergenic
1112588195 13:100738395-100738417 CTTCTGTGCTGTGGCTCTGGTGG + Intergenic
1113865507 13:113519856-113519878 GTTCTGTGCAGTGGCTTGGGTGG + Intronic
1116340722 14:43720369-43720391 TGTTTTTGCAGTGGTTCATGTGG - Intergenic
1116434917 14:44886223-44886245 TTTCTGTGCAGTGGGAAAGGTGG - Intergenic
1116558340 14:46342653-46342675 TTTCTCTGCATTGTATCAGGAGG + Intergenic
1116629781 14:47315449-47315471 TTTCTTGGCAGGGTCTCAGTAGG + Intronic
1116990407 14:51269962-51269984 TTTATTTACAGGGGCTCAGATGG - Intergenic
1117882437 14:60325457-60325479 TTTCTTTTCATTGGCTTATGTGG + Intergenic
1118176297 14:63443546-63443568 TTTCAGTGCAGTGGTACAGGTGG - Intronic
1118558336 14:67051040-67051062 ATTCTTGGCAGCCGCTCAGGTGG + Intronic
1119446283 14:74666596-74666618 TCTCTCTGCAGTGCCTCAGGAGG + Intronic
1119924140 14:78475507-78475529 TTTCTTTCAAGTATCTCAGGTGG + Intronic
1120294862 14:82626902-82626924 TCTATCTGCAGTGGGTCAGGAGG + Intergenic
1121461274 14:94080680-94080702 TTTTTTTGCCGTGGCGCAGCGGG - Intronic
1121544621 14:94754376-94754398 TTTCTCTGAAGGTGCTCAGGAGG - Intergenic
1122235084 14:100326850-100326872 TGTAATCGCAGTGGCTCAGGAGG + Intronic
1122524225 14:102369144-102369166 TTTATTTGTGGTGGCTTAGGAGG - Intronic
1128491008 15:68144407-68144429 TTTCTGTGAAGTGGTTCATGGGG - Intronic
1128694826 15:69753506-69753528 TTCCTCAACAGTGGCTCAGGAGG + Intergenic
1130969247 15:88719104-88719126 TTTCTTTGGGGTGGGTGAGGTGG + Intergenic
1131256882 15:90868948-90868970 TTTATTTGCTGTGCCTGAGGTGG + Intronic
1131445804 15:92497198-92497220 TTTCTTTCCAGAGGCTCTGGGGG + Intronic
1131674372 15:94655814-94655836 TTTCAGTTCAGGGGCTCAGGTGG + Intergenic
1131751495 15:95512665-95512687 TTTCTTGGCTGTGGCACAGTGGG - Intergenic
1132082964 15:98883283-98883305 TCTCTAGGCAGTGGCTCAGTGGG + Intronic
1134327380 16:13219535-13219557 TTTACTTACAGAGGCTCAGGGGG - Intronic
1137690222 16:50421158-50421180 TTTCTGTGCCTTGTCTCAGGTGG + Intergenic
1140017642 16:71203728-71203750 TGTCTTTGCAGAGGCTCATATGG + Intronic
1140700226 16:77574752-77574774 TTTTTTGGCAGGGGCTGAGGGGG + Intergenic
1142471557 17:165977-165999 TGTCTTTCCAGTGGCTCTGGTGG + Intronic
1143121174 17:4607935-4607957 TTTCCTGGCAGTGGCCCAGAGGG - Exonic
1143361498 17:6375148-6375170 TTTCTGTGCAGTGACTCAGACGG - Intergenic
1145837187 17:27963500-27963522 TCTTTTTCCAGTGGCTCAGAGGG + Intergenic
1147679648 17:42233350-42233372 TTCCTTAGCAGTAACTCAGGAGG - Intronic
1150160928 17:62897195-62897217 TCTCTTTGCAGTGGCAGAGGTGG + Intergenic
1150488936 17:65561407-65561429 TTTCTTTGAAGCGGCTCCGCTGG + Intronic
1154315728 18:13301820-13301842 TTTCTCTGCAGGGTCTGAGGTGG + Intronic
1155420642 18:25651898-25651920 CTTCTTTGTATTGTCTCAGGGGG + Intergenic
1156117644 18:33805405-33805427 TTTCTTTGTAGGGGGTCAGAAGG + Intergenic
1159549993 18:69884895-69884917 TGTCTTTGCAGTCTCTTAGGAGG + Intronic
1161668848 19:5593171-5593193 TTTCTTTTCAGTTGCTCATGAGG - Intronic
1163148875 19:15399651-15399673 TCTCTGTGCAGTGGGCCAGGAGG + Intronic
1164383107 19:27752080-27752102 TTTCATTACAATGCCTCAGGGGG + Intergenic
1164472778 19:28550000-28550022 TTTCTTCTAAGTGGCTCAGGAGG + Intergenic
1166116233 19:40656686-40656708 TTTCTGAGCAGTGGCCCAGCAGG - Intergenic
1166452621 19:42914933-42914955 TTTTTTTGCACTGACTCTGGCGG + Intronic
1167566497 19:50260906-50260928 TTTGTGTGCAGGGGCCCAGGTGG + Intronic
1167700031 19:51037779-51037801 TTTCCTGGCAGTGTCTCAGCTGG + Intergenic
925558768 2:5164597-5164619 TTTTTATGCAGTGCCTCAGTGGG - Intergenic
925715555 2:6781528-6781550 TTACTTAGCAGTGGCTGAGCAGG + Intergenic
926278150 2:11421600-11421622 TGTCGTTGCTGAGGCTCAGGAGG - Intergenic
927768743 2:25838887-25838909 TTTATTTCCAGTGTCTCAGGAGG + Intronic
928311729 2:30216952-30216974 TTTTTGTGCATTGGCTCAAGAGG - Intergenic
928343959 2:30472693-30472715 TTTTTTTGCAGGGAGTCAGGAGG + Intronic
935863218 2:107356976-107356998 TTTCTGTGTTCTGGCTCAGGTGG - Intergenic
937700343 2:124856961-124856983 TTTCTGGGCTGTGGCTCATGGGG + Intronic
938144208 2:128820599-128820621 TTTCTTTCCAGTGGCTCTGTCGG + Intergenic
938236302 2:129709494-129709516 TCTCTTTGCAGCTGCTCTGGGGG - Intergenic
938865800 2:135418816-135418838 CCTCTTTGTAGTGTCTCAGGAGG - Intronic
939567318 2:143800411-143800433 TTTCAGTGCTGTGGCCCAGGGGG + Intergenic
941115960 2:161472594-161472616 TTTTTTTGTAATGGCTAAGGAGG - Intronic
941159982 2:162024873-162024895 TTTCTTTGCAGTGGCTCAGGAGG - Exonic
941268190 2:163390499-163390521 TTCCTTTGCAGTGGCTCCTTAGG - Intergenic
942859161 2:180588995-180589017 TTTTTTTGCATTTGCTGAGGAGG + Intergenic
943231101 2:185253349-185253371 TTTCTTTGCTGTGTCCCAGTTGG - Intergenic
944506008 2:200411934-200411956 TTCCTTTCCACTGGCTCAGGGGG - Intronic
945412828 2:209532734-209532756 TTTCTGTGCAGAGGAACAGGAGG - Intronic
948150908 2:235744130-235744152 TTTCTTTGCAGAGGTGCAGCAGG + Intronic
1168972473 20:1940061-1940083 TTTGTTTGCCCTGGCTCAGAAGG + Intronic
1169765049 20:9139912-9139934 TTTCTTTGAAGGGGCTGAGGTGG + Intronic
1170548641 20:17456422-17456444 TGTGTTTGCACTGGCTCTGGAGG + Exonic
1174139513 20:48403317-48403339 TTTCTCTCCTGGGGCTCAGGGGG - Intergenic
1178253132 21:31023728-31023750 TGGCTTTGCAGGGGCTCAGGAGG - Intergenic
1178452473 21:32715797-32715819 TTTCTTTTCACTGACTCAGTTGG + Intronic
1178635316 21:34297473-34297495 TTTCTTTGCAGTTGCTCCCTTGG - Intergenic
1180750716 22:18122455-18122477 CATCTGTGCAGTGGCCCAGGAGG - Intronic
1181834641 22:25593725-25593747 TTTCTTTGCAGTTGCTTTTGAGG + Intronic
1184020375 22:41817088-41817110 TTTCCCTGCAGTGGCCCATGTGG - Intronic
949725308 3:7037603-7037625 GTTCTTTGCAGTTCCTCAAGAGG - Intronic
952983621 3:38758367-38758389 TTTATATGCAGTGGCTATGGTGG - Intronic
953918768 3:46937569-46937591 TTTCTCTCCAGTGGCAAAGGAGG + Intronic
955600232 3:60637083-60637105 TTCTTTTGCAGTGACTCAGAGGG - Intronic
955953634 3:64266790-64266812 TTTATTTGCAGTTGTTTAGGTGG - Intronic
956615139 3:71163421-71163443 TTTTTTGGCTGTGACTCAGGTGG + Intronic
960568310 3:119158337-119158359 TTTGTTTGTAGTGGGTGAGGTGG + Intronic
960706202 3:120484029-120484051 TTTCTTTCCCGTGGCTCAGTAGG - Intergenic
961189747 3:124948765-124948787 TTTCTTTGCACTTGCACTGGGGG + Intronic
961632314 3:128310157-128310179 ATTCTTGGCAGTGCCTCAGATGG - Intronic
961966364 3:130908363-130908385 ATTCTTTTCAGTGGCTCACAGGG - Intronic
962608839 3:137055793-137055815 TTTGTTTGCCCTGGCTCATGTGG + Intergenic
964282018 3:155078115-155078137 TGTATTTCCAGTTGCTCAGGAGG + Intronic
964605153 3:158553063-158553085 TTTCCCTGCAGTGCCTCAAGAGG + Intergenic
965500803 3:169454079-169454101 TTTCTTTGGAAAGGCTCATGAGG + Intronic
965728348 3:171744310-171744332 TTTCTTGGCACGGGCACAGGTGG - Intronic
966038774 3:175454406-175454428 TTTCTTTGCAGTCTCTTGGGAGG + Intronic
968572895 4:1351696-1351718 TTTATTTTCAATTGCTCAGGTGG + Exonic
970019303 4:11548935-11548957 TTTCTAAGCAGTGACTCAGAAGG + Intergenic
970320734 4:14873138-14873160 CTTCTTAGCATTGGCTCAGGGGG - Intergenic
972931321 4:44074703-44074725 TTTCTATGCATTGGCTGAGTTGG + Intergenic
974033752 4:56799122-56799144 TTTCTTTGCAGTGGATTTGGTGG - Intergenic
975161600 4:71130929-71130951 TTTCTTTCCAGTGACACAGTGGG + Intergenic
981046352 4:140268406-140268428 TTTCTTAGCAGAGGCCCAAGTGG - Intronic
981804145 4:148693475-148693497 ATTCTATGCAGTGGAACAGGAGG + Intergenic
983231165 4:165130252-165130274 TTCCTTGGCAGAGGCTCAGATGG + Intronic
983461258 4:168028042-168028064 TTTGTTTGGAGTGACCCAGGTGG + Intergenic
983904152 4:173168009-173168031 TTTCTTTTCATTAGCTCAGGAGG + Intergenic
985688849 5:1295716-1295738 TCTCTTTGCAGGTTCTCAGGCGG + Intergenic
985931832 5:3064494-3064516 TCTCGCTGCAGTGGCTCAGCCGG + Intergenic
986236750 5:5917782-5917804 TCTCTGTACAGTGGCTCTGGCGG - Intergenic
989422214 5:41253284-41253306 GTTCTTTGCTGGGCCTCAGGTGG + Intronic
990391158 5:55322735-55322757 TTTATTTGTAATGCCTCAGGAGG + Intronic
993033706 5:82733714-82733736 TTTCTATGGTGTGCCTCAGGGGG + Intergenic
996362401 5:122664557-122664579 TATCTTTTCAGTGGATGAGGAGG - Intergenic
996619738 5:125485576-125485598 TTTCTTTGCAGCATGTCAGGAGG - Intergenic
997278085 5:132615329-132615351 TTTCATTTCGGTGGCTAAGGAGG + Intronic
997335669 5:133107420-133107442 CTGCTTTGCAGGGGCACAGGGGG + Intergenic
998478840 5:142444632-142444654 TTTAGTTGAGGTGGCTCAGGTGG - Intergenic
998758311 5:145404894-145404916 TTTCTCTGAATTGGCTCTGGGGG + Intergenic
999338049 5:150741050-150741072 TTTCTTTTAAATGGCTGAGGTGG + Intronic
999896118 5:156035486-156035508 TATATTTGCAGTTACTCAGGAGG + Intronic
1001054070 5:168434986-168435008 TTTTTTTCCAGTTGCTCAGTTGG - Intronic
1001704181 5:173729939-173729961 TTTCATGGCAGAGGCTCTGGGGG - Intergenic
1001970266 5:175949678-175949700 TCCCTTTGCAGTGTCACAGGTGG - Intronic
1002247172 5:177894086-177894108 TCCCTTTGCAGTGTCACAGGTGG + Intergenic
1003864331 6:10349524-10349546 CTTGTTTGCAGTGGCAAAGGAGG - Intergenic
1005841870 6:29748984-29749006 TTTCCTCGCAGTGGCTCAAGCGG + Intergenic
1009226569 6:61025217-61025239 TTACTTTGCAATATCTCAGGGGG + Intergenic
1010840098 6:80638908-80638930 TATCTCTGCAGTGACGCAGGAGG - Intergenic
1015062708 6:128986406-128986428 GGTCTTTTCAGTGGATCAGGTGG + Intronic
1017124328 6:151051555-151051577 TTTCTTTTCAGTAGGTCAGTCGG + Intronic
1017750134 6:157483667-157483689 TTACATAGAAGTGGCTCAGGAGG + Intronic
1020401743 7:7786407-7786429 TTTCATTGCAGTCTATCAGGTGG + Intronic
1021283139 7:18745403-18745425 TTTCTTGGCAGTGGATTATGGGG + Intronic
1021898422 7:25259233-25259255 TGTATTTGGAGTGGCTCAGCGGG + Intergenic
1022316193 7:29247551-29247573 TGTCTGTGCAGTGGCTAAGAAGG + Intronic
1023152816 7:37217860-37217882 TTTCAATGCAGTGGGTCAGCAGG - Intronic
1023923595 7:44648934-44648956 TCTCTTTGCAGTGTCCCCGGAGG + Intronic
1024324027 7:48094791-48094813 TTTCTCTGCATTGGCTCCCGTGG - Exonic
1024767411 7:52676058-52676080 TTTCTTTGCATTGGCTGGGAAGG - Intergenic
1027145591 7:75691920-75691942 TTTCTTTGCAGGGGGTGGGGAGG + Intronic
1027401660 7:77814953-77814975 TGTCATTGCAGCTGCTCAGGAGG + Intronic
1029238239 7:99141872-99141894 TTTCTGTTCAGTGGCTCAGTCGG - Intronic
1029356747 7:100057744-100057766 TTCCTTTGCAGTTCCTGAGGAGG - Exonic
1032426609 7:131827726-131827748 TTTCTTTGCCTGGGCTCTGGGGG + Intergenic
1035283521 7:157792383-157792405 CCTCTTTGCTGTGGCTCTGGCGG + Intronic
1035817864 8:2561139-2561161 TTTGGATGCAGGGGCTCAGGTGG - Intergenic
1036685027 8:10903916-10903938 CTTCTCTGCAGTGGCTCACTTGG + Intronic
1036770594 8:11575994-11576016 TTTCCCGGCAGTGGGTCAGGTGG + Intergenic
1037536792 8:19832236-19832258 TCTGTTTTCAGTGGCTGAGGGGG + Intronic
1037551040 8:19971704-19971726 CTTCCTTCCAGTTGCTCAGGAGG + Intergenic
1037629381 8:20639597-20639619 TGTCCTTGCAGTTTCTCAGGTGG + Intergenic
1037788495 8:21917377-21917399 AATCTTTGCTGTGGCTCAAGAGG - Intergenic
1037876064 8:22549122-22549144 TGTGTTTACTGTGGCTCAGGTGG + Intronic
1039153846 8:34533356-34533378 TTTCTTTTTAGTTGCTCAGAAGG - Intergenic
1041364674 8:57089293-57089315 TTTCTTTGCAGGGACACAGATGG - Intergenic
1043309430 8:78839719-78839741 TTTCTCTGCCTTGGCTCAGAAGG - Intergenic
1043581719 8:81722294-81722316 TACCTTTGCAGTGGCTCACCAGG - Intronic
1043772762 8:84225429-84225451 ATTCTTTGCAGTGGCTTACAAGG + Intronic
1044839094 8:96322891-96322913 CTTCTTGGCTGTGGCTCAAGTGG - Intronic
1046683788 8:117201852-117201874 TTTAGGTGCAGTGGCACAGGAGG - Intergenic
1046757809 8:117989645-117989667 TTTCTTTTGAGTGGCTGAGTGGG - Intronic
1047457785 8:125031883-125031905 TCTCTTGGCAGTGGCCCAGCAGG + Intronic
1049987202 9:962519-962541 TTTCTATGCTGTGGTCCAGGAGG + Intronic
1050513160 9:6414976-6414998 TTGCTTTGCTGTGCCTCAAGTGG + Intronic
1051274008 9:15381736-15381758 TTTCCTTCAAGTGGCTCAGGAGG - Intergenic
1051642361 9:19235289-19235311 TTTCTTTGCAGTGGATCATTAGG + Intronic
1053194146 9:36102473-36102495 ATTCTAAGCAGTGACTCAGGGGG + Intronic
1053225610 9:36353318-36353340 ATCCTTTGCAGAGGCTGAGGAGG + Exonic
1058142084 9:101367595-101367617 TTACTTAGCAGGGGCTGAGGAGG - Intronic
1059427291 9:114229140-114229162 TTTCTTAGCAAAGGCTCAGCTGG + Intronic
1060042598 9:120312263-120312285 TTACTTTTAAGTGGCTCATGTGG - Intergenic
1062244967 9:135561547-135561569 GTTCTTGGCAGGGCCTCAGGCGG - Intergenic
1186468704 X:9804590-9804612 CTTCCTTGCAGTGGGTCAGATGG - Intronic
1186600352 X:11030175-11030197 TTTCTTTGCTCTGGCTCTTGTGG + Intergenic
1186763105 X:12743459-12743481 TTTTGTTGCAGGGGGTCAGGGGG - Intergenic
1187325616 X:18284376-18284398 TTTCGTTGCACTGGCTCTTGAGG - Intronic
1187415872 X:19092881-19092903 TTTCTTTGCAGGGAGTGAGGAGG - Intronic
1187711696 X:22060881-22060903 TTACTTTGCAGTTGTTCAGAAGG + Intronic
1188973198 X:36642115-36642137 TTACTTTACTGTGGCTCAGCTGG + Intergenic
1189065861 X:37808082-37808104 TTTCTGTCCAGTGTCTCAGCTGG + Intronic
1189127008 X:38459496-38459518 ATTCTTTGCAGTGGAGCAGCTGG - Intronic
1189169876 X:38898606-38898628 TTTGTTTGGAGTGGCTGTGGTGG - Intergenic
1191015298 X:55803326-55803348 TTTCTTTCAAATGGCTCAGTTGG + Intergenic
1192392046 X:70739911-70739933 TGTATTTCCAGTTGCTCAGGAGG - Intronic
1195039900 X:101004437-101004459 TCTGTGGGCAGTGGCTCAGGTGG - Intergenic
1196214645 X:113036109-113036131 TGTCTTTGCAGGGGGTGAGGTGG + Intergenic
1200217195 X:154373186-154373208 TTGCTTTCCAGTGGGGCAGGGGG - Intronic
1201245557 Y:12000041-12000063 TTTCTTTGTAGTGTCTCTGCCGG + Intergenic
1201389274 Y:13479769-13479791 TTTCCTTGCAGCCGCTGAGGAGG - Exonic