ID: 941164728

View in Genome Browser
Species Human (GRCh38)
Location 2:162073327-162073349
Sequence GCTCCGTCTTACCACGCTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 12
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 10}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941164728 Original CRISPR GCTCCGTCTTACCACGCTAA GGG (reversed) Intronic
918376324 1:183912807-183912829 TGTCCGTCTTAGCATGCTAAGGG - Intronic
1098799403 12:74934857-74934879 GCTCCATCTTACAACCATAATGG - Intergenic
1106081094 13:26500864-26500886 GCTCCTTCTCTCCAGGCTAAGGG - Intergenic
1137794025 16:51199583-51199605 GCTCCCTCTTCCCACACTAAAGG - Intergenic
1142994617 17:3753330-3753352 GCTCCATTTTACCACGTTCATGG - Exonic
1146519071 17:33512175-33512197 GCTCAGTCTGACCAAGATAAGGG + Intronic
1165325978 19:35115004-35115026 GCTCCCTCCTACCACTCTTAAGG - Intergenic
925247741 2:2399506-2399528 GCTCCTCCTTGCCCCGCTAAAGG + Intergenic
928281841 2:29953411-29953433 TCTCAGTCTTCCCACCCTAAGGG + Intergenic
941164728 2:162073327-162073349 GCTCCGTCTTACCACGCTAAGGG - Intronic
945936513 2:215907801-215907823 GCTCTGTGTTCCCAAGCTAATGG + Intergenic
1043709743 8:83401848-83401870 TCTCAGTGTTACCACACTAATGG - Intergenic