ID: 941167130

View in Genome Browser
Species Human (GRCh38)
Location 2:162094676-162094698
Sequence CTTGGATCTCAGCAGTGCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 167}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941167120_941167130 23 Left 941167120 2:162094630-162094652 CCTTAGCCCCTCAGAGACCTCTG 0: 1
1: 0
2: 2
3: 32
4: 243
Right 941167130 2:162094676-162094698 CTTGGATCTCAGCAGTGCAAGGG 0: 1
1: 0
2: 0
3: 12
4: 167
941167121_941167130 17 Left 941167121 2:162094636-162094658 CCCCTCAGAGACCTCTGTCCTCA 0: 1
1: 0
2: 3
3: 51
4: 380
Right 941167130 2:162094676-162094698 CTTGGATCTCAGCAGTGCAAGGG 0: 1
1: 0
2: 0
3: 12
4: 167
941167119_941167130 24 Left 941167119 2:162094629-162094651 CCCTTAGCCCCTCAGAGACCTCT 0: 1
1: 0
2: 1
3: 19
4: 205
Right 941167130 2:162094676-162094698 CTTGGATCTCAGCAGTGCAAGGG 0: 1
1: 0
2: 0
3: 12
4: 167
941167125_941167130 -1 Left 941167125 2:162094654-162094676 CCTCAGCAGATGTGACCGCCTTC 0: 1
1: 0
2: 0
3: 9
4: 225
Right 941167130 2:162094676-162094698 CTTGGATCTCAGCAGTGCAAGGG 0: 1
1: 0
2: 0
3: 12
4: 167
941167123_941167130 15 Left 941167123 2:162094638-162094660 CCTCAGAGACCTCTGTCCTCAGC 0: 1
1: 0
2: 3
3: 47
4: 462
Right 941167130 2:162094676-162094698 CTTGGATCTCAGCAGTGCAAGGG 0: 1
1: 0
2: 0
3: 12
4: 167
941167124_941167130 6 Left 941167124 2:162094647-162094669 CCTCTGTCCTCAGCAGATGTGAC 0: 1
1: 0
2: 0
3: 22
4: 282
Right 941167130 2:162094676-162094698 CTTGGATCTCAGCAGTGCAAGGG 0: 1
1: 0
2: 0
3: 12
4: 167
941167122_941167130 16 Left 941167122 2:162094637-162094659 CCCTCAGAGACCTCTGTCCTCAG 0: 1
1: 0
2: 2
3: 43
4: 370
Right 941167130 2:162094676-162094698 CTTGGATCTCAGCAGTGCAAGGG 0: 1
1: 0
2: 0
3: 12
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941167130 Original CRISPR CTTGGATCTCAGCAGTGCAA GGG Intergenic
901514389 1:9735219-9735241 CTTGGAGCCCACCTGTGCAAAGG + Intronic
905702274 1:40026487-40026509 GGTGGATCTTGGCAGTGCAAGGG - Intergenic
908104082 1:60823384-60823406 TTTTGATCTCAGAAGTGTAAGGG - Intergenic
909543646 1:76818853-76818875 CTTGGCTCTCATCATTGCTATGG + Intergenic
915550799 1:156632650-156632672 AATGGATCCTAGCAGTGCAAAGG - Intergenic
915729322 1:158041970-158041992 ATTGGACCTCAGAAGTTCAAGGG + Intronic
918157982 1:181868896-181868918 CTGGGATCTTAGCATTGAAAGGG + Intergenic
919676531 1:200389230-200389252 CTTGGACCTGAGTAGTGCAGTGG + Intergenic
920159869 1:203988330-203988352 CTTGGATTTCACCAGGGTAATGG + Intergenic
923224358 1:231925402-231925424 CTTGACTCTCTGCAGTACAAGGG - Intronic
1062836877 10:641417-641439 CATGGAACCCAGCAGTGCAGAGG - Intronic
1063818559 10:9807357-9807379 AGTGAATCTAAGCAGTGCAAGGG - Intergenic
1064604348 10:17023145-17023167 CCTGGATCTCAGCTGTTCAGTGG + Intronic
1067772315 10:49135612-49135634 CCTGGATCTCTGCAGTTCCAGGG + Intergenic
1068617622 10:59137132-59137154 ATTGAAGCACAGCAGTGCAATGG - Intergenic
1070815676 10:79321604-79321626 ACTGGATCTGAGCAGTGCAAGGG + Intergenic
1071450670 10:85789524-85789546 CTTGGATCTGGGCACTGCACAGG - Intronic
1074580226 10:114711945-114711967 CTAGGAGCACAGCAGGGCAAAGG + Intergenic
1075662999 10:124211101-124211123 AGAGGATCTGAGCAGTGCAAGGG + Intergenic
1076520688 10:131079050-131079072 GATGCAGCTCAGCAGTGCAAAGG - Intergenic
1077540305 11:3143478-3143500 CATGGATCACATCTGTGCAACGG + Intronic
1079180717 11:18191003-18191025 CTTGGATCTTAGCAGCTGAAGGG - Intronic
1079843674 11:25435925-25435947 GTTGAATCTCAGCTGTACAATGG + Intergenic
1085991710 11:81855572-81855594 TTTGAATCTCAGATGTGCAAAGG - Intergenic
1086023969 11:82267724-82267746 AATGGATCCAAGCAGTGCAAAGG + Intergenic
1086184624 11:83998802-83998824 CCTGGAACCCAGCAGTGCCAGGG + Intronic
1086600032 11:88622277-88622299 CTTGGATCTCATCTAAGCAAGGG - Intronic
1087264349 11:96044175-96044197 CTTGGGTCTCAGAAGTGCTGGGG + Intronic
1087882452 11:103433950-103433972 CTTGGATTTCAGAATTGCTAAGG - Intronic
1088230221 11:107666327-107666349 CTTGGATCAGAACAGTGCCAGGG - Exonic
1088724866 11:112625214-112625236 CCTGGATCACAGCTGTGCACGGG - Intergenic
1091072358 11:132579754-132579776 GTTGAATCTCAGCAGTCTAATGG + Intronic
1091254119 11:134168704-134168726 CTGGGATCTCTGTAGTGCACTGG - Intronic
1091714655 12:2768257-2768279 ATGGGATCTTAGCAGAGCAATGG - Intergenic
1092648772 12:10610188-10610210 TTTGGATCTCAGTGTTGCAAAGG - Intronic
1094579872 12:31724743-31724765 CTCTGAGCTCAGCAGTGCAGAGG + Intronic
1101231881 12:102749775-102749797 CTTAGTTCTCAGCAATGCAGTGG - Intergenic
1102049344 12:109851143-109851165 CTTGGATCTTAGCAGCTGAAGGG + Exonic
1102481000 12:113223090-113223112 TTTAAATCTCAGCAGTGGAAAGG - Intronic
1103243041 12:119430966-119430988 CTTTGAGCTCAGCTCTGCAAAGG - Intronic
1103567933 12:121826471-121826493 CTAGGACAGCAGCAGTGCAAAGG + Intronic
1104157272 12:126145489-126145511 CCTGGAGCTCAGCTGTGGAAAGG - Intergenic
1106444440 13:29813218-29813240 TTTGGCTCTCAGCAAGGCAAAGG - Intronic
1106909123 13:34444360-34444382 CTGGGAAATCTGCAGTGCAAAGG + Intergenic
1107166548 13:37288505-37288527 CCTGTATCTGAGCAGTGTAAAGG + Intergenic
1107615887 13:42167638-42167660 CTAGGACCTCAGCAGAGGAAAGG - Intronic
1107675575 13:42793464-42793486 CTTTGATTTCAGCATTGCATAGG - Intergenic
1117231783 14:53726586-53726608 CTTGGCACTCAGTAGTGAAAAGG - Intergenic
1117800543 14:59440085-59440107 AATGGATCTGAGCAGTTCAAAGG - Intronic
1117909444 14:60622824-60622846 CTTGCATTTCAGCAATGCCAAGG - Intergenic
1117973631 14:61276684-61276706 CTTGGATATAAGAAGTCCAAGGG - Intronic
1119899339 14:78246523-78246545 CTTGGAACAGAGCAGTGCAAAGG + Intronic
1122119233 14:99542983-99543005 CCTGGATCCCAGCATTCCAAAGG + Intronic
1122895815 14:104756406-104756428 CTTGGATCTCTGTAGTAAAACGG + Intronic
1123797958 15:23792990-23793012 CTTGCAGCTCAGAAGTGCCATGG - Intergenic
1124002449 15:25770400-25770422 CTTGGACCCCAGCAGGCCAAGGG + Intronic
1126490365 15:49229926-49229948 GTTTGGCCTCAGCAGTGCAATGG + Intronic
1127499598 15:59543948-59543970 CTTAGATATCAGCAGCACAACGG - Intergenic
1128492501 15:68162842-68162864 CTGGGATCACAGAAGTCCAAAGG + Intronic
1129114093 15:73355377-73355399 CATGAATCTCTGCAGTGCAGAGG + Intronic
1129526112 15:76215668-76215690 CTTGGACCTCAGCTGTGCCCTGG + Exonic
1131814927 15:96212260-96212282 CATGGATCTCAGCATAGAAAAGG - Intergenic
1132895061 16:2224836-2224858 ATTGGATCTCAGCACTGTGAAGG + Intronic
1135193678 16:20376711-20376733 TTTGGATCTCAGCTGAGGAATGG - Intronic
1136296027 16:29302502-29302524 CTGGAATCACAGCAGTGCATGGG + Intergenic
1141903509 16:87007814-87007836 CTTGGGTCTCAGCCCTGCAGAGG - Intergenic
1144998536 17:19287608-19287630 CTTGGAAATCAGCAGTGGGAAGG + Intronic
1146619515 17:34386597-34386619 CCTGGAGCCCAGCAGTGCTAGGG - Intergenic
1148625705 17:49067454-49067476 CTGGCATCTCAGCAGTGGCAGGG + Intergenic
1148754291 17:49964574-49964596 CTTCGATCCCAGCACTGCAGTGG - Intergenic
1150139084 17:62713615-62713637 CTTGTAGCTCAGGAGTGTAAAGG - Intronic
1151346496 17:73505953-73505975 CTTGCATCCTAGCAGTGCCAGGG + Intronic
1153066674 18:1053177-1053199 CTTGAATTTCAGTAGTGAAATGG - Intergenic
1157833081 18:50875343-50875365 TTGGGATCTGAGCAGTGAAAAGG - Intergenic
1158889567 18:61860160-61860182 CATGGGTCTCAGAAGTGCATGGG + Intronic
1160772606 19:839785-839807 CTGGGACCTCAGCAGGGCAGAGG - Intergenic
1161036814 19:2089617-2089639 CTGGGACCTCAGCAGAGCAGAGG - Intronic
1161072117 19:2267793-2267815 CTGGGACCTCAGCAGGGCAGAGG + Intronic
1161126551 19:2561136-2561158 CTGGGACCTCAGCAGGGCAGAGG + Intronic
1161126867 19:2562767-2562789 CTGGGAACTCAGCAGGGCAGAGG - Intronic
1161144740 19:2670896-2670918 CTGGGACCTCAGCAGGGCAGAGG - Intronic
1161148575 19:2694695-2694717 CTGGGACCTCAGCAGGGCAGAGG + Intronic
1161212852 19:3076582-3076604 CTGGGACCTCAGCAGGGCAGAGG - Intergenic
1161244873 19:3245445-3245467 CTGGGAGCTCTGCAGTGAAAGGG - Intronic
1161294896 19:3514602-3514624 CTGGGACCTCAGCAGGGCAGAGG - Intronic
1161391727 19:4024589-4024611 CTGGGACCTCAGCAGGGCAGAGG - Intronic
1161467103 19:4437112-4437134 CCTGGGGCTCAGCAGTGCAGCGG + Intronic
1162342587 19:10100710-10100732 CTTGAATGTCAGCTCTGCAAGGG - Intronic
1163785789 19:19274284-19274306 CTTGGAACTGAGCAGTGGAAAGG + Intergenic
1166782321 19:45349074-45349096 CTGGGATCTCAGAAGGTCAAGGG - Intronic
926706666 2:15842418-15842440 ATATGATCTCATCAGTGCAAGGG - Intergenic
926808596 2:16736203-16736225 CTTGGATCACAGCTGTGGCAAGG + Intergenic
929262689 2:39883337-39883359 CCTGGATCTCAGCCGAGCAGAGG + Intergenic
929915938 2:46135680-46135702 CTCGGTTATCAGCACTGCAATGG + Intronic
941167130 2:162094676-162094698 CTTGGATCTCAGCAGTGCAAGGG + Intergenic
947087008 2:226464844-226464866 CTTGAATAACAGCAGTGCATAGG - Intergenic
1172319334 20:33984124-33984146 CTTGGATCTCGGGAGGGAAATGG - Intergenic
1173178449 20:40783360-40783382 CTTGGAACCCAGCAGTGCATTGG - Intergenic
1173714177 20:45187848-45187870 CCCGGATCCCAGCAGTGCCAGGG + Intergenic
1173854150 20:46239181-46239203 CTGGGAACACAGCAGTGAAAAGG - Intronic
1174458440 20:50666006-50666028 CTTGGGACTCAGCATTACAAGGG - Intronic
1176286870 21:5023039-5023061 CTAGGAAATCAGCAGTGCCAGGG - Intronic
1177200063 21:17944151-17944173 CATGGATCTCAGCAAAGCAAAGG + Intronic
1177655456 21:24011130-24011152 CTGGGACCTCAGCTGTGTAAGGG + Intergenic
1179410534 21:41159580-41159602 CTAAGATCTCACCAGTGCAGAGG - Intergenic
1179870311 21:44240436-44240458 CTAGGAAATCAGCAGTGCCAGGG + Intronic
1182671261 22:31997806-31997828 TTTAGTTCTCAGCAGTGCAAGGG + Intergenic
1184417928 22:44363024-44363046 CTAGGAGCCCAGCAGTGCCAGGG - Intergenic
1185029554 22:48434508-48434530 TTTGGATCTCAGCAATGGAATGG + Intergenic
950194254 3:10998167-10998189 CTTGGATTTCAGCCTAGCAAAGG - Intronic
950271767 3:11621996-11622018 CTTACATCTCAACAGTACAAAGG - Intronic
950568592 3:13786350-13786372 CTTGGACCTGAGCAATTCAAAGG + Intergenic
953045995 3:39294579-39294601 CTTCGATCACAGAAGAGCAAGGG + Intergenic
957242595 3:77677833-77677855 CATGAATCTCAGCAGTATAAAGG + Intergenic
962694861 3:137938018-137938040 AGTGGATTTGAGCAGTGCAAAGG - Intergenic
963296129 3:143548452-143548474 CTGGGAGCTGAGCAGTGCTAGGG - Intronic
963301256 3:143599609-143599631 TTTGCATCTCAATAGTGCAAAGG - Intronic
964373672 3:156028527-156028549 GTGGGATCACAGCAGTGAAAAGG - Intergenic
966030726 3:175344293-175344315 CCTGGAATTCAGTAGTGCAAAGG + Intronic
966946279 3:184779229-184779251 CTTGGGTCTCAGGAGAGCAGCGG - Intergenic
968964114 4:3760813-3760835 CTTGGATCCCAGCAGGGCCAGGG + Intergenic
970093519 4:12435874-12435896 CTTGGGTGTCTGCTGTGCAATGG + Intergenic
972879577 4:43407183-43407205 CTTGTATTTCAGATGTGCAAGGG + Intergenic
973649116 4:52979986-52980008 CTTGGACCTGTGCTGTGCAATGG - Intronic
973657188 4:53060454-53060476 CTTAGATCTCTGTACTGCAAAGG + Intronic
973974669 4:56250652-56250674 TTTGAATCTCAGCACTGCCAGGG + Intronic
974519665 4:62966830-62966852 CTTGGAACTCAACAATGAAAAGG - Intergenic
975377195 4:73659390-73659412 AGTGGATCCCAGCAGTGCTAGGG + Intergenic
979494705 4:121370342-121370364 CCTGGATCTCAGCCTTTCAATGG - Intronic
981895682 4:149796182-149796204 CTTGGATCTCACCCCTTCAAGGG - Intergenic
982979547 4:162115088-162115110 ATTTGAGCTCAGCAGTGCAGAGG + Intronic
986285933 5:6359014-6359036 CTAGGATGCCAGCAGTGCCATGG - Intergenic
986344500 5:6822337-6822359 CTTGGCTAGCAGCAGAGCAAGGG + Intergenic
990545652 5:56817524-56817546 CTTTGGTCTCAGTAGTGCCATGG - Intronic
991254735 5:64601583-64601605 AGTGGAACTCAGCAGTGCAAGGG - Intronic
991256117 5:64617217-64617239 AGTGGATCTGAGCAATGCAAGGG - Intergenic
991407758 5:66318451-66318473 CTTGAATCTCAGAGGTACAAGGG - Intergenic
994502172 5:100593015-100593037 CTGGGATCTCACCATTGCAACGG - Intergenic
998948637 5:147368261-147368283 GTTGTATTTCAGAAGTGCAAAGG - Intronic
1003346223 6:5270124-5270146 CCTGGAATTCTGCAGTGCAAAGG + Intronic
1004517382 6:16331856-16331878 CTTGGTTCTCAGTAGTGCTCAGG + Intronic
1005664251 6:28034581-28034603 CTTGATTCTCAGCACTGCTAGGG - Intergenic
1006022963 6:31128331-31128353 CTTGGCTCTCAGCATTGCACGGG + Intronic
1006569173 6:34986445-34986467 CTAGGATCTCATTAGAGCAATGG - Intronic
1008635926 6:53410968-53410990 CTTGGTTCTCAGCTTTACAATGG - Intergenic
1011313895 6:86010362-86010384 CTTGAATCTCAGCAATGAGAAGG - Intergenic
1011431315 6:87289873-87289895 TCTGGCTCCCAGCAGTGCAAGGG - Intronic
1014478892 6:121911002-121911024 CTTGGAGCTAAGTAGTTCAATGG - Intergenic
1014898210 6:126929673-126929695 CTTAAATCCCAGCAGGGCAAAGG + Intergenic
1018118284 6:160610316-160610338 CTTGCTTTTCAGCTGTGCAAGGG + Intronic
1022026396 7:26452035-26452057 CCTGGATATCTGAAGTGCAATGG - Intergenic
1022192445 7:28029753-28029775 CTTGGCTCTGATCATTGCAAAGG - Intronic
1022546666 7:31195687-31195709 CTTGAATCTCAGGAATGCCACGG - Intergenic
1023844182 7:44111867-44111889 CATGGATCCCAGCAGTGTAGCGG - Exonic
1023994996 7:45154260-45154282 CTTGTCACTCAGGAGTGCAATGG - Intergenic
1025739999 7:64187293-64187315 GTGGGATCTCAGCAGAGAAATGG + Intronic
1028344272 7:89760883-89760905 CTTGGAACCCAGCAGTGCTGGGG + Intergenic
1029603417 7:101583451-101583473 CGTGGATCTGAGTGGTGCAAGGG + Intergenic
1033221865 7:139532288-139532310 CTTGGATTTGTGCAGTGCAGTGG + Intronic
1034051812 7:147991697-147991719 CTTGGATCTCTGAAGGGCCAAGG - Intronic
1034310625 7:150084724-150084746 CTTTGGTCTCAGATGTGCAAAGG + Intergenic
1035260273 7:157656639-157656661 CTTGGATCTTAGCAGGAGAAGGG - Intronic
1035680944 8:1487723-1487745 CTTGGGACGCAGCAGTGCACAGG - Intergenic
1035726389 8:1826965-1826987 CTGGGAGCTCTGCAGTGGAAAGG + Intronic
1036434222 8:8718003-8718025 CTTGAATCTGTGCAGTGCCAAGG - Intergenic
1040386827 8:46919788-46919810 CTAGGATGGCAGCAGGGCAAAGG - Intergenic
1040626828 8:49159122-49159144 TTTGGATCTCAACAGGGAAAGGG + Intergenic
1044780543 8:95739303-95739325 CTTGGATAGCAGCAGTGATAAGG + Intergenic
1045872916 8:106946550-106946572 CCTGGATCTCACCAGTGCTGTGG + Intergenic
1048455135 8:134570850-134570872 CTTGCAACTCAGCAGTGGATGGG + Intronic
1048643414 8:136389613-136389635 CTTGATTCTCATCAGGGCAAAGG + Intergenic
1053218482 9:36292466-36292488 TTGGGATCTTAGCAGTGCATGGG - Intronic
1054156124 9:61641668-61641690 CTTGGATCCCAGCAGTCTGAGGG + Intergenic
1055193587 9:73558977-73558999 TTTGGATTTCAGCAGTTTAAGGG - Intergenic
1058420125 9:104825599-104825621 CTAGAATCTCTGCAGTGCATGGG - Intronic
1060992607 9:127857497-127857519 CTGGGGACACAGCAGTGCAAAGG - Intergenic
1061723340 9:132567269-132567291 CTTGGAACTCTGAAGTGCAAGGG + Intronic
1187231862 X:17431133-17431155 AATGGATCTCAGCAGTGCCCAGG + Intronic
1187583249 X:20631796-20631818 CATGAATGTCAGCAGTGCCAAGG + Intergenic
1194525887 X:94977404-94977426 CTTGGCTCTCCCCAGTGCAGTGG - Intergenic