ID: 941168420

View in Genome Browser
Species Human (GRCh38)
Location 2:162108513-162108535
Sequence ATAAAGCATTTGAGTGGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941168420_941168422 24 Left 941168420 2:162108513-162108535 CCTGAGCCACTCAAATGCTTTAT No data
Right 941168422 2:162108560-162108582 TGCCAGCACCCCTTTCCCAAAGG No data
941168420_941168423 25 Left 941168420 2:162108513-162108535 CCTGAGCCACTCAAATGCTTTAT No data
Right 941168423 2:162108561-162108583 GCCAGCACCCCTTTCCCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941168420 Original CRISPR ATAAAGCATTTGAGTGGCTC AGG (reversed) Intergenic