ID: 941168422

View in Genome Browser
Species Human (GRCh38)
Location 2:162108560-162108582
Sequence TGCCAGCACCCCTTTCCCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941168421_941168422 18 Left 941168421 2:162108519-162108541 CCACTCAAATGCTTTATGCAATA No data
Right 941168422 2:162108560-162108582 TGCCAGCACCCCTTTCCCAAAGG No data
941168420_941168422 24 Left 941168420 2:162108513-162108535 CCTGAGCCACTCAAATGCTTTAT No data
Right 941168422 2:162108560-162108582 TGCCAGCACCCCTTTCCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941168422 Original CRISPR TGCCAGCACCCCTTTCCCAA AGG Intergenic
No off target data available for this crispr