ID: 941168423

View in Genome Browser
Species Human (GRCh38)
Location 2:162108561-162108583
Sequence GCCAGCACCCCTTTCCCAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941168420_941168423 25 Left 941168420 2:162108513-162108535 CCTGAGCCACTCAAATGCTTTAT No data
Right 941168423 2:162108561-162108583 GCCAGCACCCCTTTCCCAAAGGG No data
941168421_941168423 19 Left 941168421 2:162108519-162108541 CCACTCAAATGCTTTATGCAATA No data
Right 941168423 2:162108561-162108583 GCCAGCACCCCTTTCCCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941168423 Original CRISPR GCCAGCACCCCTTTCCCAAA GGG Intergenic