ID: 941168428

View in Genome Browser
Species Human (GRCh38)
Location 2:162108572-162108594
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941168421_941168428 30 Left 941168421 2:162108519-162108541 CCACTCAAATGCTTTATGCAATA No data
Right 941168428 2:162108572-162108594 TTTCCCAAAGGGCTGTCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type