ID: 941169625

View in Genome Browser
Species Human (GRCh38)
Location 2:162120771-162120793
Sequence ATGTGTACACACATGCATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941169621_941169625 27 Left 941169621 2:162120721-162120743 CCTTCAGAAATGGGGATGGCTCA No data
Right 941169625 2:162120771-162120793 ATGTGTACACACATGCATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941169625 Original CRISPR ATGTGTACACACATGCATCA GGG Intergenic
No off target data available for this crispr