ID: 941174885

View in Genome Browser
Species Human (GRCh38)
Location 2:162184541-162184563
Sequence CGGGACAAACAGATGGGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941174878_941174885 6 Left 941174878 2:162184512-162184534 CCGATGCATAGAGAAGTTGGGCA No data
Right 941174885 2:162184541-162184563 CGGGACAAACAGATGGGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941174885 Original CRISPR CGGGACAAACAGATGGGAAG AGG Intronic
No off target data available for this crispr