ID: 941177852

View in Genome Browser
Species Human (GRCh38)
Location 2:162221300-162221322
Sequence GCGGCGGATTTCTTGAGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941177849_941177852 -10 Left 941177849 2:162221287-162221309 CCCAGCACTTTGGGCGGCGGATT No data
Right 941177852 2:162221300-162221322 GCGGCGGATTTCTTGAGGCCAGG No data
941177843_941177852 12 Left 941177843 2:162221265-162221287 CCGGCTCGCTCACGCCAGTAATC No data
Right 941177852 2:162221300-162221322 GCGGCGGATTTCTTGAGGCCAGG No data
941177840_941177852 23 Left 941177840 2:162221254-162221276 CCCAGGCCTGGCCGGCTCGCTCA No data
Right 941177852 2:162221300-162221322 GCGGCGGATTTCTTGAGGCCAGG No data
941177841_941177852 22 Left 941177841 2:162221255-162221277 CCAGGCCTGGCCGGCTCGCTCAC No data
Right 941177852 2:162221300-162221322 GCGGCGGATTTCTTGAGGCCAGG No data
941177846_941177852 -2 Left 941177846 2:162221279-162221301 CCAGTAATCCCAGCACTTTGGGC No data
Right 941177852 2:162221300-162221322 GCGGCGGATTTCTTGAGGCCAGG No data
941177842_941177852 17 Left 941177842 2:162221260-162221282 CCTGGCCGGCTCGCTCACGCCAG No data
Right 941177852 2:162221300-162221322 GCGGCGGATTTCTTGAGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941177852 Original CRISPR GCGGCGGATTTCTTGAGGCC AGG Intronic