ID: 941178861

View in Genome Browser
Species Human (GRCh38)
Location 2:162234890-162234912
Sequence TCTAGCTGGCCGGCAAGCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941178861_941178869 -6 Left 941178861 2:162234890-162234912 CCCACGCTTGCCGGCCAGCTAGA No data
Right 941178869 2:162234907-162234929 GCTAGAGTTCTGGGTGGGCGTGG 0: 15
1: 123
2: 621
3: 635
4: 653
941178861_941178877 27 Left 941178861 2:162234890-162234912 CCCACGCTTGCCGGCCAGCTAGA No data
Right 941178877 2:162234940-162234962 CCCCACACTCCCAGCGGCCCGGG No data
941178861_941178875 26 Left 941178861 2:162234890-162234912 CCCACGCTTGCCGGCCAGCTAGA No data
Right 941178875 2:162234939-162234961 GCCCCACACTCCCAGCGGCCCGG No data
941178861_941178871 0 Left 941178861 2:162234890-162234912 CCCACGCTTGCCGGCCAGCTAGA No data
Right 941178871 2:162234913-162234935 GTTCTGGGTGGGCGTGGGCTTGG 0: 114
1: 730
2: 592
3: 341
4: 442
941178861_941178873 4 Left 941178861 2:162234890-162234912 CCCACGCTTGCCGGCCAGCTAGA No data
Right 941178873 2:162234917-162234939 TGGGTGGGCGTGGGCTTGGTGGG 0: 9
1: 179
2: 542
3: 484
4: 755
941178861_941178870 -5 Left 941178861 2:162234890-162234912 CCCACGCTTGCCGGCCAGCTAGA No data
Right 941178870 2:162234908-162234930 CTAGAGTTCTGGGTGGGCGTGGG 0: 17
1: 118
2: 599
3: 590
4: 522
941178861_941178872 3 Left 941178861 2:162234890-162234912 CCCACGCTTGCCGGCCAGCTAGA No data
Right 941178872 2:162234916-162234938 CTGGGTGGGCGTGGGCTTGGTGG 0: 74
1: 531
2: 507
3: 379
4: 869
941178861_941178874 21 Left 941178861 2:162234890-162234912 CCCACGCTTGCCGGCCAGCTAGA No data
Right 941178874 2:162234934-162234956 GGTGGGCCCCACACTCCCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941178861 Original CRISPR TCTAGCTGGCCGGCAAGCGT GGG (reversed) Intronic
No off target data available for this crispr