ID: 941180955

View in Genome Browser
Species Human (GRCh38)
Location 2:162258773-162258795
Sequence GCTGCTGGAGATTTTCATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941180955_941180961 27 Left 941180955 2:162258773-162258795 CCTGGATGAAAATCTCCAGCAGC No data
Right 941180961 2:162258823-162258845 GCTCCAGACAGTGGCCAACGGGG No data
941180955_941180957 18 Left 941180955 2:162258773-162258795 CCTGGATGAAAATCTCCAGCAGC No data
Right 941180957 2:162258814-162258836 TGAAATCCAGCTCCAGACAGTGG No data
941180955_941180959 25 Left 941180955 2:162258773-162258795 CCTGGATGAAAATCTCCAGCAGC No data
Right 941180959 2:162258821-162258843 CAGCTCCAGACAGTGGCCAACGG No data
941180955_941180960 26 Left 941180955 2:162258773-162258795 CCTGGATGAAAATCTCCAGCAGC No data
Right 941180960 2:162258822-162258844 AGCTCCAGACAGTGGCCAACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941180955 Original CRISPR GCTGCTGGAGATTTTCATCC AGG (reversed) Intergenic
No off target data available for this crispr