ID: 941180956

View in Genome Browser
Species Human (GRCh38)
Location 2:162258788-162258810
Sequence TGAAGATAATCAGAAGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941180956_941180957 3 Left 941180956 2:162258788-162258810 CCAGCAGCTTCTGATTATCTTCA No data
Right 941180957 2:162258814-162258836 TGAAATCCAGCTCCAGACAGTGG No data
941180956_941180961 12 Left 941180956 2:162258788-162258810 CCAGCAGCTTCTGATTATCTTCA No data
Right 941180961 2:162258823-162258845 GCTCCAGACAGTGGCCAACGGGG No data
941180956_941180960 11 Left 941180956 2:162258788-162258810 CCAGCAGCTTCTGATTATCTTCA No data
Right 941180960 2:162258822-162258844 AGCTCCAGACAGTGGCCAACGGG No data
941180956_941180959 10 Left 941180956 2:162258788-162258810 CCAGCAGCTTCTGATTATCTTCA No data
Right 941180959 2:162258821-162258843 CAGCTCCAGACAGTGGCCAACGG No data
941180956_941180964 27 Left 941180956 2:162258788-162258810 CCAGCAGCTTCTGATTATCTTCA No data
Right 941180964 2:162258838-162258860 CAACGGGGCCCTGTGTGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941180956 Original CRISPR TGAAGATAATCAGAAGCTGC TGG (reversed) Intergenic
No off target data available for this crispr