ID: 941180960

View in Genome Browser
Species Human (GRCh38)
Location 2:162258822-162258844
Sequence AGCTCCAGACAGTGGCCAAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941180955_941180960 26 Left 941180955 2:162258773-162258795 CCTGGATGAAAATCTCCAGCAGC No data
Right 941180960 2:162258822-162258844 AGCTCCAGACAGTGGCCAACGGG No data
941180954_941180960 27 Left 941180954 2:162258772-162258794 CCCTGGATGAAAATCTCCAGCAG No data
Right 941180960 2:162258822-162258844 AGCTCCAGACAGTGGCCAACGGG No data
941180956_941180960 11 Left 941180956 2:162258788-162258810 CCAGCAGCTTCTGATTATCTTCA No data
Right 941180960 2:162258822-162258844 AGCTCCAGACAGTGGCCAACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941180960 Original CRISPR AGCTCCAGACAGTGGCCAAC GGG Intergenic
No off target data available for this crispr