ID: 941180964

View in Genome Browser
Species Human (GRCh38)
Location 2:162258838-162258860
Sequence CAACGGGGCCCTGTGTGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941180958_941180964 -5 Left 941180958 2:162258820-162258842 CCAGCTCCAGACAGTGGCCAACG No data
Right 941180964 2:162258838-162258860 CAACGGGGCCCTGTGTGAGCTGG No data
941180956_941180964 27 Left 941180956 2:162258788-162258810 CCAGCAGCTTCTGATTATCTTCA No data
Right 941180964 2:162258838-162258860 CAACGGGGCCCTGTGTGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941180964 Original CRISPR CAACGGGGCCCTGTGTGAGC TGG Intergenic
No off target data available for this crispr