ID: 941181790

View in Genome Browser
Species Human (GRCh38)
Location 2:162268142-162268164
Sequence CAGTGTGCTAGCCTGTTCTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 169}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941181790_941181796 29 Left 941181790 2:162268142-162268164 CCCCAGAACAGGCTAGCACACTG 0: 1
1: 0
2: 2
3: 18
4: 169
Right 941181796 2:162268194-162268216 TGGGTTATTCTTGTAATGCTTGG 0: 1
1: 0
2: 1
3: 10
4: 195
941181790_941181794 9 Left 941181790 2:162268142-162268164 CCCCAGAACAGGCTAGCACACTG 0: 1
1: 0
2: 2
3: 18
4: 169
Right 941181794 2:162268174-162268196 CAAAGGAAAGTTATTAGTGATGG 0: 1
1: 0
2: 5
3: 18
4: 247
941181790_941181795 10 Left 941181790 2:162268142-162268164 CCCCAGAACAGGCTAGCACACTG 0: 1
1: 0
2: 2
3: 18
4: 169
Right 941181795 2:162268175-162268197 AAAGGAAAGTTATTAGTGATGGG 0: 1
1: 0
2: 3
3: 38
4: 349
941181790_941181793 -8 Left 941181790 2:162268142-162268164 CCCCAGAACAGGCTAGCACACTG 0: 1
1: 0
2: 2
3: 18
4: 169
Right 941181793 2:162268157-162268179 GCACACTGCAGTTTTTGCAAAGG 0: 1
1: 0
2: 1
3: 8
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941181790 Original CRISPR CAGTGTGCTAGCCTGTTCTG GGG (reversed) Exonic
901608411 1:10477032-10477054 CAGGCTGCCAGCATGTTCTGTGG - Intronic
902244916 1:15114570-15114592 CACTGTTCCAGCCTGCTCTGGGG - Exonic
903354568 1:22738589-22738611 CCGTGTGCTTTCCTGTTCTAGGG + Intronic
912181938 1:107229608-107229630 CAGTGTGTTGGGCTGCTCTGTGG + Intronic
913538267 1:119795045-119795067 CAGGCTGCTGGCCTGTCCTGCGG + Intronic
916688767 1:167171432-167171454 CTGTCTGCTTCCCTGTTCTGAGG - Intergenic
917756444 1:178104048-178104070 GAGTGGGCTTTCCTGTTCTGAGG + Intronic
923855366 1:237839519-237839541 CAGGGTGCTAGCGGGTTCTGGGG - Intergenic
924111667 1:240705719-240705741 CACTGTGCCAGACTGTTTTGTGG - Intergenic
924914776 1:248554918-248554940 CAGTTTGCTAGCATTTTTTGAGG + Intergenic
1066351847 10:34643026-34643048 CAGTGTTCTATCCTGCCCTGTGG + Intronic
1067336425 10:45369167-45369189 CAGTTTGCTAGCATTTTTTGAGG - Intergenic
1069240217 10:66129611-66129633 CAGTCTACTGGCCTCTTCTGGGG + Intronic
1069668761 10:70183830-70183852 CAGAGTGGTAGCCTGTTCACAGG - Intergenic
1072530426 10:96313603-96313625 TACTGTGCTAGGCTGTTGTGAGG + Intronic
1072713932 10:97737051-97737073 AAGGGTGCTTGCCTGTGCTGGGG + Intergenic
1073863154 10:107770531-107770553 CAGTCTGCTGGCCTCTCCTGGGG + Intergenic
1074125682 10:110527324-110527346 AAGGGGGCTAGCCTGTACTGAGG + Intergenic
1075201562 10:120408799-120408821 CAGTGTCCTTGCCCTTTCTGGGG + Intergenic
1075398142 10:122142513-122142535 CAGGGTGCTAGCCTGTCAGGTGG + Intronic
1076983450 11:218140-218162 CAGTGTATTAGTCTGTTCTCTGG - Intronic
1081334083 11:41842707-41842729 CAGTATGATAGCCTTTTTTGGGG - Intergenic
1081816805 11:45949610-45949632 TAGTGTGCTTGCCTCTGCTGAGG - Intronic
1081822928 11:46017798-46017820 CTGTTTGATAGCCTTTTCTGTGG - Intronic
1083976374 11:66124903-66124925 CAGCGGGCAAGCCTGTACTGAGG - Intronic
1084074447 11:66762242-66762264 CAGTTTGCGCGCGTGTTCTGCGG - Intronic
1091186141 11:133649569-133649591 ACGTGTGCTTGCCTGTGCTGCGG - Intergenic
1092006643 12:5075754-5075776 CAGTGGGCTGAGCTGTTCTGTGG + Intergenic
1096558404 12:52418447-52418469 CAGAGTGATAGCATGTTCTGTGG - Intergenic
1097895378 12:64820033-64820055 CAGGGAGCCAGCCTGCTCTGGGG - Intronic
1098247228 12:68532825-68532847 GAGGCTGCAAGCCTGTTCTGAGG + Intergenic
1100155420 12:91793985-91794007 CAGTGTTCTCCCCTTTTCTGTGG + Intergenic
1101073026 12:101096530-101096552 CTCTGTGCGAGGCTGTTCTGTGG - Exonic
1101397544 12:104361740-104361762 CTGTGGGGTAGCCTGCTCTGTGG + Intergenic
1107178736 13:37430999-37431021 CAGTGTTCAAGCCTTATCTGTGG + Intergenic
1108732671 13:53251218-53251240 GTGTGTGCTAGCTTGTTCTAAGG + Intergenic
1109666992 13:65552977-65552999 TAGAGTGCTAGCATGTGCTGAGG + Intergenic
1110139597 13:72112250-72112272 CAGTGTATTAGTCTGTTCTCAGG + Intergenic
1112860125 13:103819936-103819958 CAGTGTGTTAGTCTGTTTTGAGG + Intergenic
1114702688 14:24694890-24694912 CAGTGCTCTGGACTGTTCTGCGG + Intergenic
1114917907 14:27289883-27289905 TAGTGTGCTAGTCTGTTCTAAGG + Intergenic
1116336760 14:43666356-43666378 CAGTGTGCTAGCGAGTAATGGGG - Intergenic
1117964958 14:61197523-61197545 GAGTGTGCTAGCATGTACTCAGG + Intronic
1118408285 14:65449542-65449564 CAGTGTGCTTTTCTCTTCTGAGG + Intronic
1120840579 14:89081692-89081714 CGGCGTGCAGGCCTGTTCTGAGG - Intergenic
1122807636 14:104268306-104268328 TAATGTGGTAGCCTGTTCTTTGG - Intergenic
1125221597 15:37343264-37343286 CAGTGTGCAAACCTGGTGTGTGG - Intergenic
1132797483 16:1732340-1732362 CATCGTGCCTGCCTGTTCTGGGG + Intronic
1133141618 16:3748750-3748772 CAGTGTGGTAGCCTCTTCCCAGG - Intronic
1133371545 16:5249222-5249244 CTGTGTGGCACCCTGTTCTGGGG + Intergenic
1134169591 16:11957817-11957839 CAGTCTGCTGGCCTGCCCTGCGG + Intronic
1135567829 16:23525486-23525508 CAATGTTCAAGCCTGTTTTGAGG + Intronic
1137672048 16:50284699-50284721 CAGTGGGCAAGCCTGGGCTGAGG + Intronic
1139418206 16:66831256-66831278 CAGTGTGCTCACCTGTGCAGTGG + Intronic
1140327555 16:74019873-74019895 GAGTGTGCTTACCTGGTCTGGGG + Intergenic
1140395638 16:74624325-74624347 CAATGTGCCAGCCTCTTCTAGGG + Intronic
1140557943 16:75943139-75943161 CAGGCTGCTAGCCTGTCTTGTGG + Intergenic
1142983903 17:3686255-3686277 CTGTGTGTTCTCCTGTTCTGAGG - Intronic
1142984028 17:3686588-3686610 CTGTGTGTTCTCCTGTTCTGAGG - Intronic
1142984151 17:3686921-3686943 CTGTGTGTTCTCCTGTTCTGAGG - Intronic
1142984222 17:3687118-3687140 CTGTGTGTTCTCCTGTTCTGAGG - Intronic
1142984267 17:3687247-3687269 CTGTGTGTTCTCCTGTTCTGAGG - Intronic
1142984337 17:3687444-3687466 CTGTGTGTTCTCCTGTTCTGAGG - Intronic
1142984362 17:3687512-3687534 CTGTGTGTTCTCCTGTTCTGAGG - Intronic
1142984407 17:3687641-3687663 CTGTGTGTTCTCCTGTTCTGAGG - Intronic
1142984477 17:3687838-3687860 CTGTGTGTTCTCCTGTTCTGAGG - Intronic
1142984502 17:3687906-3687928 CTGTGTGTTCTCCTGTTCTGAGG - Intronic
1144154875 17:12490228-12490250 TAATGTGCTAGGCTGTGCTGAGG - Intergenic
1145766159 17:27459547-27459569 CAGCGTTCTTTCCTGTTCTGTGG + Intronic
1149448987 17:56734772-56734794 CACGGTGCTAGACTTTTCTGGGG - Intergenic
1152485985 17:80593281-80593303 CAGGTTACCAGCCTGTTCTGAGG + Intronic
1153061799 18:1002815-1002837 CAGTGAGCTAGCCTTTTCCATGG - Intergenic
1154013609 18:10596633-10596655 CAGTGCGGTGGCCTGTTCTGTGG - Intergenic
1154013783 18:10598219-10598241 CATTGTGTTAGCTTGTACTGGGG + Intergenic
1154152831 18:11920215-11920237 CAGTGTGGTGGCCTGTTCTGTGG - Intergenic
1154153026 18:11921937-11921959 CATTGTGTTAGCTTGTACTGGGG + Intergenic
1155377686 18:25178817-25178839 CACTGTGGGAGCCTGTGCTGAGG - Intronic
1155606697 18:27614211-27614233 AAATGTGTTACCCTGTTCTGAGG - Intergenic
1160121979 18:76138954-76138976 CAGTGTGTCAGCCCGTGCTGGGG + Intergenic
1161082664 19:2319257-2319279 CAGTGTGGGGGGCTGTTCTGAGG + Intronic
1163265389 19:16217632-16217654 CAGTCTGCTGGCCTCTCCTGGGG - Intronic
1167179578 19:47892420-47892442 GAGTGTGCTTGACTGGTCTGTGG - Intergenic
926191758 2:10733688-10733710 CAGTATCTTAGCCTGTTTTGCGG + Intronic
928804965 2:35140079-35140101 CAGAGTGCTAGCAGGTGCTGGGG + Intergenic
929874292 2:45783705-45783727 CAGTATCCTAACCTGTTCTCTGG + Intronic
931172344 2:59816545-59816567 CAATGTGCCAAACTGTTCTGGGG + Intergenic
935028746 2:99302356-99302378 CAGTGTGCCAGGCTGTTATCTGG - Intronic
935341634 2:102064311-102064333 CGGTGTGCTGGCCTGCTCTGTGG + Intergenic
935375193 2:102388455-102388477 CTGTGTGATTGCCTGTGCTGTGG + Intronic
937956224 2:127423069-127423091 CCGTGCGCCAGCCTGTGCTGCGG + Exonic
938179558 2:129168351-129168373 CAGAGTGCTGTCCTGTTCTTAGG + Intergenic
941181790 2:162268142-162268164 CAGTGTGCTAGCCTGTTCTGGGG - Exonic
944436516 2:199695950-199695972 CTGTCTGCTGGCCTGTCCTGGGG + Intergenic
945424281 2:209680798-209680820 CACTGTGACAGTCTGTTCTGAGG - Exonic
945633042 2:212307833-212307855 AAGTGTGGTGGCCTGTTCTGGGG - Intronic
948447511 2:238044365-238044387 CAGTGTCCTAGCCCATTCAGAGG + Intronic
948575832 2:238949058-238949080 CAGTGAGCTAGCCTCATCAGTGG - Intergenic
948856162 2:240731684-240731706 CAGTGAGCTTGCCTGAGCTGGGG - Intronic
1173095753 20:40026489-40026511 AAGTGGGCTAGACTGTTCTGGGG - Intergenic
1174847161 20:53953663-53953685 CGGTGTGATAGTCTTTTCTGTGG + Exonic
1174994243 20:55547542-55547564 CAGTGAGCAAGTTTGTTCTGTGG - Intergenic
1179613303 21:42566102-42566124 AAGTGTGCAAGCCTGGTCTGGGG + Intronic
1179932602 21:44580137-44580159 CTGTGTGCCCACCTGTTCTGAGG - Exonic
1180801891 22:18635848-18635870 CAGTGTGCCTGTCTGTTCCGTGG - Intergenic
1180853129 22:19031389-19031411 CAGTGTGCCTGTCTGTTCCGTGG - Intergenic
1181219829 22:21359413-21359435 CAGTGTGCCTGTCTGTTCCGTGG + Intergenic
1183341493 22:37284256-37284278 CAGTGTGCTATGCAGTGCTGGGG + Intronic
1184178791 22:42805543-42805565 CAGTGTCCTGGCCTGTTGTCAGG - Intronic
951173160 3:19566604-19566626 CAGTGTATTAGTCTGTTCTTGGG - Intergenic
952814916 3:37438771-37438793 CAGTGTCCTTGACTGTCCTGAGG - Intergenic
954581972 3:51707791-51707813 CAGTTTCCTTTCCTGTTCTGAGG + Intronic
954988205 3:54814328-54814350 CAGTGTGCTTGCCTGTAAAGTGG - Intronic
955133134 3:56190274-56190296 CAGGGTGCTAGCCCTTTCTGTGG + Intronic
955722862 3:61902142-61902164 CAGACTGTTAGCCTGCTCTGGGG + Intronic
956989677 3:74748815-74748837 CAGTTTGCTATCATGTGCTGTGG + Intergenic
961513630 3:127419719-127419741 CAGTGAGGTGGCCTTTTCTGGGG - Intergenic
961933167 3:130554971-130554993 CTGTCTGCTGGCCTCTTCTGGGG - Intergenic
962351645 3:134660725-134660747 GAGTGTGCAAGCTTGTCCTGTGG + Intronic
963063907 3:141247161-141247183 CAGTGAGCAAGGCTCTTCTGTGG + Intronic
963472076 3:145753118-145753140 CAGGGTGCTACTCTGATCTGAGG - Intergenic
968633360 4:1664647-1664669 CAGTGTGATTGCCTGTGTTGAGG - Intronic
969875415 4:10132479-10132501 CTGTCTGCTCTCCTGTTCTGAGG + Intergenic
975416896 4:74114842-74114864 CAGTGTGCTGGCTTTTTCTATGG + Intronic
978596138 4:110379420-110379442 CAGTCTGCTGGCCTCTCCTGAGG + Intronic
985377532 4:189356460-189356482 CACTGTGCTCACCTGTTCTGGGG + Intergenic
985892998 5:2730635-2730657 CAGTTTCCTTGCCTGTCCTGTGG + Intergenic
988306372 5:29499157-29499179 CAATCTGCTGGCCTCTTCTGGGG - Intergenic
988348492 5:30070238-30070260 CAGGGTGCTAGCGGGTGCTGGGG - Intergenic
989967033 5:50476305-50476327 GAGTGTGCTACTCTGTTCTCAGG - Intergenic
990840706 5:60076856-60076878 CAGTGTGCTAGCAGGTGCTGGGG + Intronic
991220770 5:64213435-64213457 CAGAAAGCTAGCCTTTTCTGTGG + Intronic
991568128 5:68026299-68026321 CAGTCTGCTACCCTGGTCAGGGG - Intergenic
998510184 5:142706677-142706699 CAGGGTCCTAGCCTGCTATGGGG + Intergenic
1000420156 5:161029351-161029373 CAGTGTGCTAGTGTGGTCTGGGG + Intergenic
1003038342 6:2664455-2664477 CAGTGTGCATGCGTGTGCTGGGG - Exonic
1003091241 6:3105482-3105504 CAGTGAACCAGGCTGTTCTGTGG - Exonic
1004073639 6:12325434-12325456 CAGTGTGCAAGATTGGTCTGGGG + Intergenic
1004277030 6:14245910-14245932 CGGTGTCCAAGCATGTTCTGTGG + Intergenic
1004344901 6:14840182-14840204 CAGAGTTCTAGCCTCTTCTTGGG - Intergenic
1004834110 6:19511553-19511575 CAGAGTGCTTGCCAGTGCTGGGG + Intergenic
1006438306 6:34038426-34038448 CTATGTGCCAGCCTGTGCTGAGG - Intronic
1007158608 6:39770694-39770716 CAGTGTCCTAGTATGCTCTGTGG - Intergenic
1007399957 6:41597940-41597962 CTGTGTGCTCACCTGTACTGGGG - Exonic
1010336121 6:74685193-74685215 TAGTCTGCTGGCCTCTTCTGGGG + Intergenic
1013372312 6:109481942-109481964 CACTGTGCTGGCCAGTTTTGAGG - Exonic
1014900070 6:126952447-126952469 CAATGTTGTAGCCTGTTGTGTGG - Intergenic
1018870508 6:167778903-167778925 CAAACTGCTAGACTGTTCTGAGG - Intergenic
1019074709 6:169378009-169378031 CGGTGTGCCAGCCTGCCCTGCGG - Intergenic
1021101961 7:16594510-16594532 CAGTCTGCCAGCCTGTTCTGTGG - Intergenic
1021529264 7:21624930-21624952 CAGTTTGCTAGACTTTGCTGAGG + Intronic
1023097263 7:36673717-36673739 CAGTGTGGTAACCTGTACTTGGG - Intronic
1023547876 7:41338403-41338425 CTGTGTGCTAGTTTGTTCTGTGG + Intergenic
1025067748 7:55872370-55872392 CAGTGAGCTAGCCTGCACTGAGG + Intergenic
1025241745 7:57282379-57282401 CAGGCTGCTGGCCTGTCCTGTGG + Intergenic
1026166518 7:67914933-67914955 CAGGCTGCTGGCCTGTCCTGTGG + Intergenic
1026217018 7:68358580-68358602 CAGTGTGCTAGCAAGAACTGGGG - Intergenic
1028622590 7:92841364-92841386 CGGTGTACCAGTCTGTTCTGTGG - Intergenic
1028774169 7:94658526-94658548 ATGTGTGCTAGCCGGCTCTGAGG - Intronic
1029137081 7:98380951-98380973 CAGTATGCTGGGCTGTGCTGTGG - Intronic
1030807582 7:113936591-113936613 CAGGGTGCTAGCAGGTGCTGCGG + Intronic
1030817014 7:114050877-114050899 CATTCTGCTGGCCTTTTCTGTGG + Intronic
1033105611 7:138519433-138519455 CACTATGCTGGCCTGTACTGGGG + Intronic
1036717511 8:11139876-11139898 CAGTGTGCTTTCCTTGTCTGTGG - Intronic
1037408286 8:18566914-18566936 GTGTGTGCTTGCCTGTTCTGGGG + Intronic
1037448733 8:18995579-18995601 CAGTGTATTAGTCTGTTCTCAGG + Intronic
1040116810 8:43631058-43631080 CATTGTTCTAGCTTTTTCTGGGG - Intergenic
1040360734 8:46661904-46661926 CAGTGAGCTAGCCTGCACTGTGG - Intergenic
1040528859 8:48249052-48249074 CACTCTGCTAAGCTGTTCTGTGG + Intergenic
1040608979 8:48963664-48963686 CACTCTGCTAAGCTGTTCTGTGG - Intergenic
1043738278 8:83774951-83774973 CTGTCTGCTGGCCTGTCCTGGGG + Intergenic
1044793570 8:95872749-95872771 CAGGGTGCTAGCAGGTACTGGGG - Intergenic
1046176779 8:110585746-110585768 TGGTGTGCTAGCCTCTTATGAGG - Intergenic
1047598889 8:126406829-126406851 CATTGTGTTAAACTGTTCTGAGG + Intergenic
1049506981 8:143008112-143008134 CAGGGTGCTAGCAAGTGCTGGGG + Intergenic
1056006487 9:82277300-82277322 GAGTGTATTAGTCTGTTCTGAGG + Intergenic
1057040662 9:91845237-91845259 CAGGGTGAGAGCCTGTCCTGGGG + Intronic
1060683529 9:125586709-125586731 CAGTGTGCAAGCCTTCTGTGAGG - Intronic
1062136322 9:134930236-134930258 CAGGGTGCGAGGATGTTCTGGGG + Intergenic
1062722713 9:138052879-138052901 CAGTGTGCCAGGCTGCTTTGTGG + Intronic
1185474939 X:409557-409579 AAGTGTACTAGTCTGTTCTCAGG - Intergenic
1187823487 X:23312405-23312427 CAGTGTGCTTTCCTGTTATGTGG - Intergenic
1188797116 X:34481048-34481070 CAGTGTGCTAGCAAGTGCTAGGG + Intergenic
1188852756 X:35151394-35151416 CAGGGTGCTAGTGTGTGCTGGGG - Intergenic
1189040497 X:37537723-37537745 CAGTCTGCTGGCCTCTTGTGGGG - Intronic
1193894678 X:87098626-87098648 CAGGGTGCTAGCAGGTGCTGGGG + Intergenic
1194412663 X:93576391-93576413 CAGGGTGCCAGCATCTTCTGAGG - Intergenic
1194874744 X:99173172-99173194 CAGAGTGCTAGCAGGTGCTGGGG - Intergenic
1194925707 X:99820449-99820471 CAGAGTGCTAGCAGGTGCTGGGG - Intergenic
1194971432 X:100348376-100348398 TTGTGTGCTATGCTGTTCTGGGG - Intronic
1196045541 X:111252480-111252502 CAGGCTGCTAGGCTGTTATGAGG - Exonic