ID: 941196993

View in Genome Browser
Species Human (GRCh38)
Location 2:162465043-162465065
Sequence GGGGAAAGTCTAGGAATAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941196987_941196993 21 Left 941196987 2:162464999-162465021 CCATGATCATTTCATAAAAGAAT No data
Right 941196993 2:162465043-162465065 GGGGAAAGTCTAGGAATAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941196993 Original CRISPR GGGGAAAGTCTAGGAATAAA AGG Intronic
No off target data available for this crispr