ID: 941197032

View in Genome Browser
Species Human (GRCh38)
Location 2:162465752-162465774
Sequence GTAAAGGTGCATCCTGTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941197030_941197032 -9 Left 941197030 2:162465738-162465760 CCATTAAGTATCATGTAAAGGTG No data
Right 941197032 2:162465752-162465774 GTAAAGGTGCATCCTGTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941197032 Original CRISPR GTAAAGGTGCATCCTGTTGT GGG Intronic
No off target data available for this crispr