ID: 941203956

View in Genome Browser
Species Human (GRCh38)
Location 2:162548292-162548314
Sequence TCCCTAAGGCTGCCAGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941203951_941203956 12 Left 941203951 2:162548257-162548279 CCTTGCAGCAGGTAGCTGCTACA No data
Right 941203956 2:162548292-162548314 TCCCTAAGGCTGCCAGAGGCAGG No data
941203949_941203956 30 Left 941203949 2:162548239-162548261 CCAGGCTTGGACACAAGGCCTTG No data
Right 941203956 2:162548292-162548314 TCCCTAAGGCTGCCAGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941203956 Original CRISPR TCCCTAAGGCTGCCAGAGGC AGG Intronic
No off target data available for this crispr