ID: 941204323

View in Genome Browser
Species Human (GRCh38)
Location 2:162552761-162552783
Sequence ATCACTGCTTTCGGCTCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941204323_941204329 3 Left 941204323 2:162552761-162552783 CCCTGGGAGCCGAAAGCAGTGAT No data
Right 941204329 2:162552787-162552809 TAAACAGCCAGGAGGAAAGTGGG No data
941204323_941204332 24 Left 941204323 2:162552761-162552783 CCCTGGGAGCCGAAAGCAGTGAT No data
Right 941204332 2:162552808-162552830 GGGACACAGTCTTATGACCATGG No data
941204323_941204327 -5 Left 941204323 2:162552761-162552783 CCCTGGGAGCCGAAAGCAGTGAT No data
Right 941204327 2:162552779-162552801 GTGATGAATAAACAGCCAGGAGG No data
941204323_941204326 -8 Left 941204323 2:162552761-162552783 CCCTGGGAGCCGAAAGCAGTGAT No data
Right 941204326 2:162552776-162552798 GCAGTGATGAATAAACAGCCAGG No data
941204323_941204328 2 Left 941204323 2:162552761-162552783 CCCTGGGAGCCGAAAGCAGTGAT No data
Right 941204328 2:162552786-162552808 ATAAACAGCCAGGAGGAAAGTGG No data
941204323_941204330 4 Left 941204323 2:162552761-162552783 CCCTGGGAGCCGAAAGCAGTGAT No data
Right 941204330 2:162552788-162552810 AAACAGCCAGGAGGAAAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941204323 Original CRISPR ATCACTGCTTTCGGCTCCCA GGG (reversed) Intronic