ID: 941204688

View in Genome Browser
Species Human (GRCh38)
Location 2:162557362-162557384
Sequence ATAAGCTATTGGGCCAATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941204682_941204688 22 Left 941204682 2:162557317-162557339 CCAAAAATGGGCGTTCAATTGCA No data
Right 941204688 2:162557362-162557384 ATAAGCTATTGGGCCAATTAAGG No data
941204685_941204688 -7 Left 941204685 2:162557346-162557368 CCAAGAGGCAGGAAGCATAAGCT No data
Right 941204688 2:162557362-162557384 ATAAGCTATTGGGCCAATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941204688 Original CRISPR ATAAGCTATTGGGCCAATTA AGG Intronic
No off target data available for this crispr