ID: 941220086

View in Genome Browser
Species Human (GRCh38)
Location 2:162767485-162767507
Sequence CTCCAATAGCAGTAAAACTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941220086_941220087 9 Left 941220086 2:162767485-162767507 CCATAGTTTTACTGCTATTGGAG No data
Right 941220087 2:162767517-162767539 TTATATTTAACTCATCTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941220086 Original CRISPR CTCCAATAGCAGTAAAACTA TGG (reversed) Intronic
No off target data available for this crispr