ID: 941220252

View in Genome Browser
Species Human (GRCh38)
Location 2:162769523-162769545
Sequence GCCTTCTATAGACTATACTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941220248_941220252 10 Left 941220248 2:162769490-162769512 CCCACATACTGCTATTGCAACCG No data
Right 941220252 2:162769523-162769545 GCCTTCTATAGACTATACTAAGG No data
941220251_941220252 -10 Left 941220251 2:162769510-162769532 CCGGCTTATAACAGCCTTCTATA No data
Right 941220252 2:162769523-162769545 GCCTTCTATAGACTATACTAAGG No data
941220247_941220252 17 Left 941220247 2:162769483-162769505 CCTCTTGCCCACATACTGCTATT No data
Right 941220252 2:162769523-162769545 GCCTTCTATAGACTATACTAAGG No data
941220249_941220252 9 Left 941220249 2:162769491-162769513 CCACATACTGCTATTGCAACCGG No data
Right 941220252 2:162769523-162769545 GCCTTCTATAGACTATACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941220252 Original CRISPR GCCTTCTATAGACTATACTA AGG Intronic
No off target data available for this crispr