ID: 941223196

View in Genome Browser
Species Human (GRCh38)
Location 2:162811119-162811141
Sequence CTAATGTTCTAGAGGGCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941223196_941223201 20 Left 941223196 2:162811119-162811141 CCCTTTGCCCTCTAGAACATTAG No data
Right 941223201 2:162811162-162811184 GAAGTGAGATAGGAACCCGAAGG No data
941223196_941223200 10 Left 941223196 2:162811119-162811141 CCCTTTGCCCTCTAGAACATTAG No data
Right 941223200 2:162811152-162811174 TGAATACTATGAAGTGAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941223196 Original CRISPR CTAATGTTCTAGAGGGCAAA GGG (reversed) Intronic
No off target data available for this crispr