ID: 941223893

View in Genome Browser
Species Human (GRCh38)
Location 2:162820520-162820542
Sequence ACAATGACCTCAACATTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941223891_941223893 8 Left 941223891 2:162820489-162820511 CCTGCATCTTCTTGGTACTATTT No data
Right 941223893 2:162820520-162820542 ACAATGACCTCAACATTCAAGGG No data
941223888_941223893 23 Left 941223888 2:162820474-162820496 CCTCCATTGACTTTGCCTGCATC No data
Right 941223893 2:162820520-162820542 ACAATGACCTCAACATTCAAGGG No data
941223889_941223893 20 Left 941223889 2:162820477-162820499 CCATTGACTTTGCCTGCATCTTC No data
Right 941223893 2:162820520-162820542 ACAATGACCTCAACATTCAAGGG No data
941223887_941223893 30 Left 941223887 2:162820467-162820489 CCTTATACCTCCATTGACTTTGC No data
Right 941223893 2:162820520-162820542 ACAATGACCTCAACATTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941223893 Original CRISPR ACAATGACCTCAACATTCAA GGG Intronic
No off target data available for this crispr