ID: 941227517

View in Genome Browser
Species Human (GRCh38)
Location 2:162867541-162867563
Sequence CTGGATCTGTCTGGTTTTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941227513_941227517 -9 Left 941227513 2:162867527-162867549 CCTATTATATCACCCTGGATCTG No data
Right 941227517 2:162867541-162867563 CTGGATCTGTCTGGTTTTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941227517 Original CRISPR CTGGATCTGTCTGGTTTTAT AGG Intergenic
No off target data available for this crispr