ID: 941238620

View in Genome Browser
Species Human (GRCh38)
Location 2:163009222-163009244
Sequence ATTTACAAGCCCAATAAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941238620_941238624 18 Left 941238620 2:163009222-163009244 CCCTTCTTATTGGGCTTGTAAAT No data
Right 941238624 2:163009263-163009285 ATAAGTAAAAAGTAATTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941238620 Original CRISPR ATTTACAAGCCCAATAAGAA GGG (reversed) Intergenic
No off target data available for this crispr