ID: 941244266

View in Genome Browser
Species Human (GRCh38)
Location 2:163077819-163077841
Sequence ATGAATAAACATGAATAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941244266_941244274 27 Left 941244266 2:163077819-163077841 CCCTCCTATTCATGTTTATTCAT No data
Right 941244274 2:163077869-163077891 CTGGCAAAGCATGTGATCTTAGG No data
941244266_941244272 8 Left 941244266 2:163077819-163077841 CCCTCCTATTCATGTTTATTCAT No data
Right 941244272 2:163077850-163077872 CTGAGCGAAACTTTGGTTCCTGG No data
941244266_941244269 1 Left 941244266 2:163077819-163077841 CCCTCCTATTCATGTTTATTCAT No data
Right 941244269 2:163077843-163077865 TTCTTCCCTGAGCGAAACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941244266 Original CRISPR ATGAATAAACATGAATAGGA GGG (reversed) Intergenic
No off target data available for this crispr