ID: 941246433

View in Genome Browser
Species Human (GRCh38)
Location 2:163103397-163103419
Sequence TTCTTCTGCTAGAAAAAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941246433_941246435 11 Left 941246433 2:163103397-163103419 CCTTATTTTTTCTAGCAGAAGAA No data
Right 941246435 2:163103431-163103453 ACAAAGTCAAGCACTTACATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941246433 Original CRISPR TTCTTCTGCTAGAAAAAATA AGG (reversed) Intergenic
No off target data available for this crispr