ID: 941255928

View in Genome Browser
Species Human (GRCh38)
Location 2:163230980-163231002
Sequence TGGGAGAATGTCCCAGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941255928_941255940 27 Left 941255928 2:163230980-163231002 CCCTCCACTGGGACATTCTCCCA No data
Right 941255940 2:163231030-163231052 TGGGTCACCACTTTGTGCCAGGG No data
941255928_941255932 -10 Left 941255928 2:163230980-163231002 CCCTCCACTGGGACATTCTCCCA No data
Right 941255932 2:163230993-163231015 CATTCTCCCAGGTCACCAGTAGG No data
941255928_941255937 7 Left 941255928 2:163230980-163231002 CCCTCCACTGGGACATTCTCCCA No data
Right 941255937 2:163231010-163231032 AGTAGGAAATATTCAGGTATTGG No data
941255928_941255939 26 Left 941255928 2:163230980-163231002 CCCTCCACTGGGACATTCTCCCA No data
Right 941255939 2:163231029-163231051 TTGGGTCACCACTTTGTGCCAGG No data
941255928_941255935 1 Left 941255928 2:163230980-163231002 CCCTCCACTGGGACATTCTCCCA No data
Right 941255935 2:163231004-163231026 GTCACCAGTAGGAAATATTCAGG No data
941255928_941255938 8 Left 941255928 2:163230980-163231002 CCCTCCACTGGGACATTCTCCCA No data
Right 941255938 2:163231011-163231033 GTAGGAAATATTCAGGTATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941255928 Original CRISPR TGGGAGAATGTCCCAGTGGA GGG (reversed) Intergenic
No off target data available for this crispr