ID: 941255929

View in Genome Browser
Species Human (GRCh38)
Location 2:163230981-163231003
Sequence CTGGGAGAATGTCCCAGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941255929_941255937 6 Left 941255929 2:163230981-163231003 CCTCCACTGGGACATTCTCCCAG No data
Right 941255937 2:163231010-163231032 AGTAGGAAATATTCAGGTATTGG No data
941255929_941255935 0 Left 941255929 2:163230981-163231003 CCTCCACTGGGACATTCTCCCAG No data
Right 941255935 2:163231004-163231026 GTCACCAGTAGGAAATATTCAGG No data
941255929_941255940 26 Left 941255929 2:163230981-163231003 CCTCCACTGGGACATTCTCCCAG No data
Right 941255940 2:163231030-163231052 TGGGTCACCACTTTGTGCCAGGG No data
941255929_941255939 25 Left 941255929 2:163230981-163231003 CCTCCACTGGGACATTCTCCCAG No data
Right 941255939 2:163231029-163231051 TTGGGTCACCACTTTGTGCCAGG No data
941255929_941255938 7 Left 941255929 2:163230981-163231003 CCTCCACTGGGACATTCTCCCAG No data
Right 941255938 2:163231011-163231033 GTAGGAAATATTCAGGTATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941255929 Original CRISPR CTGGGAGAATGTCCCAGTGG AGG (reversed) Intergenic
No off target data available for this crispr