ID: 941255933

View in Genome Browser
Species Human (GRCh38)
Location 2:163230999-163231021
Sequence ATATTTCCTACTGGTGACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941255933_941255940 8 Left 941255933 2:163230999-163231021 CCCAGGTCACCAGTAGGAAATAT No data
Right 941255940 2:163231030-163231052 TGGGTCACCACTTTGTGCCAGGG No data
941255933_941255939 7 Left 941255933 2:163230999-163231021 CCCAGGTCACCAGTAGGAAATAT No data
Right 941255939 2:163231029-163231051 TTGGGTCACCACTTTGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941255933 Original CRISPR ATATTTCCTACTGGTGACCT GGG (reversed) Intergenic
No off target data available for this crispr