ID: 941255936 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:163231008-163231030 |
| Sequence | AATACCTGAATATTTCCTAC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 941255936_941255940 | -1 | Left | 941255936 | 2:163231008-163231030 | CCAGTAGGAAATATTCAGGTATT | No data | ||
| Right | 941255940 | 2:163231030-163231052 | TGGGTCACCACTTTGTGCCAGGG | No data | ||||
| 941255936_941255939 | -2 | Left | 941255936 | 2:163231008-163231030 | CCAGTAGGAAATATTCAGGTATT | No data | ||
| Right | 941255939 | 2:163231029-163231051 | TTGGGTCACCACTTTGTGCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 941255936 | Original CRISPR | AATACCTGAATATTTCCTAC TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||