ID: 941255940

View in Genome Browser
Species Human (GRCh38)
Location 2:163231030-163231052
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941255928_941255940 27 Left 941255928 2:163230980-163231002 CCCTCCACTGGGACATTCTCCCA No data
Right 941255940 2:163231030-163231052 TGGGTCACCACTTTGTGCCAGGG No data
941255929_941255940 26 Left 941255929 2:163230981-163231003 CCTCCACTGGGACATTCTCCCAG No data
Right 941255940 2:163231030-163231052 TGGGTCACCACTTTGTGCCAGGG No data
941255933_941255940 8 Left 941255933 2:163230999-163231021 CCCAGGTCACCAGTAGGAAATAT No data
Right 941255940 2:163231030-163231052 TGGGTCACCACTTTGTGCCAGGG No data
941255934_941255940 7 Left 941255934 2:163231000-163231022 CCAGGTCACCAGTAGGAAATATT No data
Right 941255940 2:163231030-163231052 TGGGTCACCACTTTGTGCCAGGG No data
941255927_941255940 28 Left 941255927 2:163230979-163231001 CCCCTCCACTGGGACATTCTCCC No data
Right 941255940 2:163231030-163231052 TGGGTCACCACTTTGTGCCAGGG No data
941255931_941255940 23 Left 941255931 2:163230984-163231006 CCACTGGGACATTCTCCCAGGTC No data
Right 941255940 2:163231030-163231052 TGGGTCACCACTTTGTGCCAGGG No data
941255936_941255940 -1 Left 941255936 2:163231008-163231030 CCAGTAGGAAATATTCAGGTATT No data
Right 941255940 2:163231030-163231052 TGGGTCACCACTTTGTGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr