ID: 941269525

View in Genome Browser
Species Human (GRCh38)
Location 2:163408102-163408124
Sequence TTTTTAGGCCAACATCAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941269525_941269528 14 Left 941269525 2:163408102-163408124 CCTGGCTGATGTTGGCCTAAAAA No data
Right 941269528 2:163408139-163408161 AATATCAGATAGCCTGTGCCAGG No data
941269525_941269532 28 Left 941269525 2:163408102-163408124 CCTGGCTGATGTTGGCCTAAAAA No data
Right 941269532 2:163408153-163408175 TGTGCCAGGTCAAAACTGGTGGG No data
941269525_941269529 24 Left 941269525 2:163408102-163408124 CCTGGCTGATGTTGGCCTAAAAA No data
Right 941269529 2:163408149-163408171 AGCCTGTGCCAGGTCAAAACTGG No data
941269525_941269531 27 Left 941269525 2:163408102-163408124 CCTGGCTGATGTTGGCCTAAAAA No data
Right 941269531 2:163408152-163408174 CTGTGCCAGGTCAAAACTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941269525 Original CRISPR TTTTTAGGCCAACATCAGCC AGG (reversed) Intergenic
No off target data available for this crispr