ID: 941269532

View in Genome Browser
Species Human (GRCh38)
Location 2:163408153-163408175
Sequence TGTGCCAGGTCAAAACTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941269525_941269532 28 Left 941269525 2:163408102-163408124 CCTGGCTGATGTTGGCCTAAAAA No data
Right 941269532 2:163408153-163408175 TGTGCCAGGTCAAAACTGGTGGG No data
941269527_941269532 13 Left 941269527 2:163408117-163408139 CCTAAAAATGGATTATACTGAGA No data
Right 941269532 2:163408153-163408175 TGTGCCAGGTCAAAACTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941269532 Original CRISPR TGTGCCAGGTCAAAACTGGT GGG Intergenic
No off target data available for this crispr